ID: 1005438203

View in Genome Browser
Species Human (GRCh38)
Location 6:25837391-25837413
Sequence CAGCCATTGTGGCCCTGATG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 147}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005438203 Original CRISPR CAGCCATTGTGGCCCTGATG GGG Intronic
901724329 1:11228827-11228849 TGTCCATGGTGGCCCTGATGCGG - Exonic
901847238 1:11991240-11991262 CAGATAGTGTGGCCCTCATGAGG + Intronic
902687924 1:18090997-18091019 CTTCCAACGTGGCCCTGATGAGG - Intergenic
902968698 1:20031129-20031151 TAGCCATTGTGGTTCTGATAGGG + Intronic
903581403 1:24373509-24373531 CAGCCATTGTCCTCCTGGTGGGG + Intronic
903669046 1:25024808-25024830 CAGCCACTGTAGCCCTTATGTGG - Intergenic
904916018 1:33971248-33971270 CAGCTAATGTGGCCCAGGTGGGG - Intronic
906523335 1:46479817-46479839 CAGCCCCTGTGGCCGTGCTGGGG + Intergenic
909886906 1:80953095-80953117 CAGCAATTCTGACCCTGAGGAGG - Intergenic
911192012 1:94957691-94957713 TAACCATGGTGGCCCAGATGTGG - Intergenic
912788350 1:112626059-112626081 CAGCTATTGTGGACATGAGGTGG - Intronic
916395938 1:164387257-164387279 CAGGAATTGTGGGCCTGGTGTGG - Intergenic
917356573 1:174131885-174131907 CGGCCACCTTGGCCCTGATGGGG + Intergenic
1063809624 10:9689920-9689942 CTACCATTGTGACACTGATGTGG - Intergenic
1067788225 10:49268135-49268157 CAGCCATTGTGGTCTTGGTGGGG + Intergenic
1069102970 10:64346598-64346620 CAGCCATTGTGACACTGAGGTGG - Intergenic
1076366280 10:129922735-129922757 CAGCCCTCCTGACCCTGATGTGG + Intronic
1076882213 10:133245108-133245130 CAGCCACTGAGACCCTGCTGAGG - Intergenic
1081704075 11:45170547-45170569 CAGCCCCTGTGGCTGTGATGTGG + Intronic
1083170565 11:60921942-60921964 CCGGCTTCGTGGCCCTGATGAGG + Exonic
1084043477 11:66555881-66555903 CAGCCACTGTGGCCCTCGTGAGG - Intronic
1084116521 11:67045861-67045883 CAGCCATTGTGCTCCAGGTGAGG + Exonic
1088466884 11:110149212-110149234 CAGCCAATATTCCCCTGATGAGG - Intronic
1088598414 11:111456370-111456392 CAGACATTGTGCTCCTGAGGGGG - Intronic
1089672779 11:120067992-120068014 CAGCCATGGAGGCACTGGTGGGG - Intergenic
1091538972 12:1441583-1441605 CAGCCTTTGCAGCCCAGATGTGG + Intronic
1091992201 12:4964411-4964433 CAGCCATTGTGCCCTTCTTGGGG + Intergenic
1092666768 12:10809376-10809398 CTGCCTTTATGGCCCTCATGTGG + Exonic
1094269001 12:28590661-28590683 CAGCCAGAGTGTCCCAGATGAGG + Intergenic
1096701175 12:53383936-53383958 TAGACATTGTGGGCCTCATGTGG + Intronic
1098608760 12:72427876-72427898 CAGCCAATCTGGCACAGATGTGG - Intronic
1100563324 12:95770598-95770620 CAGCCAATCTGGCCCTTCTGAGG - Intronic
1102097038 12:110249175-110249197 CAGCCTGTGAGTCCCTGATGGGG - Intergenic
1103446379 12:120997625-120997647 GAGCCATGGTGGCCATGAAGGGG - Exonic
1106818626 13:33438006-33438028 CAGCCATGGAGGCTCTGAAGTGG - Intergenic
1107348200 13:39486026-39486048 CAGACTTTGTGGCCCTGAGCAGG - Intronic
1109695505 13:65951148-65951170 CAGCTATTGAGGCCCTTATATGG - Intergenic
1110577572 13:77077196-77077218 CAGCCAGTGTGGCCCAGCAGAGG - Exonic
1113059605 13:106308046-106308068 CAGTCATTGGGGACTTGATGGGG - Intergenic
1113061723 13:106329690-106329712 CAGCCATTGTAGCTCTGATGTGG - Intergenic
1113897561 13:113775791-113775813 AAGCTCCTGTGGCCCTGATGAGG + Intronic
1117368913 14:55058013-55058035 CAGCCATTGAGACCCTGAACTGG - Intronic
1120965642 14:90165250-90165272 CAGCCTCTTTGGCCCTGATATGG - Intronic
1121009863 14:90513512-90513534 CAGCTCTTGAGGCTCTGATGGGG - Intergenic
1121428645 14:93871922-93871944 CAGCGATGGTGTCCCTGAGGAGG + Intergenic
1122206299 14:100149679-100149701 CGGCCATCAAGGCCCTGATGCGG - Exonic
1122236242 14:100332165-100332187 CAGCCAGTGTGACCCTGGGGAGG + Intergenic
1122825185 14:104367330-104367352 CGGCCATTGTGACCCAAATGGGG - Intergenic
1124954798 15:34353305-34353327 CAGCTATTGTGGGGCTGAGGTGG - Intronic
1125304838 15:38299482-38299504 CAGCCATTCTCTTCCTGATGAGG - Exonic
1126553103 15:49954113-49954135 CAGCCATTTTGGCCCTGCCCTGG + Intronic
1126908251 15:53390199-53390221 CAGCCATTGTGTTCCTGTTTGGG - Intergenic
1127237478 15:57070801-57070823 CAGCCAGTATGACCCTGCTGAGG - Intronic
1132416581 15:101624577-101624599 AAGCCATCCTGGCCCTCATGTGG + Intronic
1132758857 16:1499369-1499391 CAGCCATTCTTGCTGTGATGGGG - Intronic
1132856449 16:2047241-2047263 CAGCCGTTGAGGACCTGCTGGGG - Intronic
1134807356 16:17137348-17137370 CAGCCAAGGTGCCCTTGATGTGG - Intronic
1136090898 16:27919308-27919330 CAGCCATGATGGCCATGATAGGG - Intronic
1136579186 16:31141768-31141790 CTGGGATTGGGGCCCTGATGGGG - Exonic
1137886741 16:52112496-52112518 AAGCCATTGTAGCCTTCATGGGG - Intergenic
1138035727 16:53603926-53603948 CAGCTATTGTGGCCATGTTTTGG - Intronic
1140446398 16:75032030-75032052 CAGTCATAGTGGTTCTGATGTGG + Intronic
1141310151 16:82906289-82906311 CCTCCATGGTGGCCATGATGAGG + Intronic
1142954523 17:3512357-3512379 GAGACTTTGTGCCCCTGATGGGG - Intronic
1143188021 17:5022295-5022317 CAGCCATGGTGGCCCAGCGGGGG - Exonic
1151443543 17:74148947-74148969 CAACCATTGCTGCCCTCATGGGG - Intergenic
1152923166 17:83075993-83076015 CAGGCCTTGGGGCCCTCATGGGG - Intergenic
1154120960 18:11652173-11652195 CAGCCACTGTGGTGCTGGTGGGG + Intergenic
1155067460 18:22280075-22280097 CTGCCACTCTGGCCCTGAAGGGG + Intergenic
1160442052 18:78900463-78900485 CAGACAGCGTGGCACTGATGTGG - Intergenic
1160794917 19:940861-940883 CAGCCACAGTGGCTTTGATGAGG - Intronic
1161459132 19:4386116-4386138 CAGCCTTTGTGGCTCAGAAGAGG - Intronic
1161576146 19:5055542-5055564 CAGAGATGGTGGCCGTGATGGGG + Intronic
1163413713 19:17172793-17172815 CAGACATCGTGGCCCTGCTGCGG + Exonic
1163782165 19:19256347-19256369 CAGCCATCAGGCCCCTGATGGGG + Exonic
1167359683 19:49023507-49023529 CAGCCAGGGTGGCATTGATGGGG + Exonic
1167361448 19:49032578-49032600 CAGCCAGGGTGGCATTGATGGGG - Exonic
1167362205 19:49036207-49036229 CAGCCAGGGTGGCATTGATGGGG + Exonic
1167363878 19:49044651-49044673 CAGCCAGGGTGGCATTGATGGGG - Exonic
1167364620 19:49048276-49048298 CAGCCAGGGTGGCATTGATGGGG + Exonic
1167365905 19:49054912-49054934 CAGCCAGGGTGGCATTGATGGGG + Exonic
1168135532 19:54348948-54348970 CAGCCATTGTGGTCCTTTTCTGG - Intergenic
925123378 2:1436992-1437014 CTGCCATTGTGGACCAGAGGAGG - Intronic
925967002 2:9075600-9075622 AAGACATTTTGGCCCTGCTGGGG + Intergenic
926697975 2:15784048-15784070 CAGCCAATGTAGCCCTGTTGTGG + Intergenic
927664888 2:25024559-25024581 CAGCCATGGTGGCCCTATTCTGG + Intergenic
927956171 2:27208745-27208767 CAGCCATTGGTTCCCTGAAGGGG - Intronic
928084500 2:28337349-28337371 CTGCCATTGGTGCCCTGATGTGG + Intronic
928769743 2:34692466-34692488 CAGCCATTCTGGGCCTGGCGCGG - Intergenic
933215841 2:79629120-79629142 CAGCCATATTGGCCCTCGTGTGG + Intronic
933690086 2:85172943-85172965 AAGCCCTTGTGGCGCTGCTGTGG - Intronic
935791230 2:106592024-106592046 CAGCTATTGAGGTCCTGAGGTGG + Intergenic
937356832 2:121203023-121203045 CAGCCAGAGTGGCTTTGATGGGG + Intergenic
938588925 2:132718838-132718860 CAGCAATTTTGGCACTAATGAGG + Intronic
944500579 2:200355167-200355189 GAGCCACTGTGGCACTGCTGTGG + Intronic
947118459 2:226795642-226795664 CAGCCATGGTGGCCCTGGGCAGG + Exonic
947434272 2:230059444-230059466 GAGCCACTTTGACCCTGATGGGG - Intronic
947839495 2:233198459-233198481 CACAAATTGTGGCCCTTATGAGG - Intronic
1169210974 20:3766214-3766236 CAGCCATTGAGGCCTTGAGATGG + Intronic
1171464922 20:25320573-25320595 AAGCCTTTGTGGCCCAGAGGAGG - Intronic
1171942906 20:31348659-31348681 CAGCCATGGTGGCCATGGGGAGG + Intergenic
1173319528 20:41974914-41974936 CAGCCAATGTGACCATGAAGTGG - Intergenic
1173521025 20:43700489-43700511 CAGCCATTGAGCCCGTGTTGTGG + Intronic
1173656007 20:44700783-44700805 CAGCCACTGTGGCCACAATGGGG + Intergenic
1173687242 20:44932258-44932280 CTGCCATGGTGTCCCTGAGGAGG + Intronic
1174049180 20:47755810-47755832 CAGGCCTTGTGGCCATGGTGGGG - Intronic
1174622469 20:51886387-51886409 CAGGCATTGTGGACCTCGTGAGG + Intergenic
1180600018 22:17009483-17009505 CAGACATGGGGGACCTGATGAGG + Intergenic
1181106772 22:20580245-20580267 CACCCACTTTGGCCCTGAAGCGG - Intronic
1181800823 22:25346876-25346898 CCGCCCGTGTGGCCCTGGTGTGG - Intergenic
1182749794 22:32632398-32632420 CAGCCACTGAGACCCTGAAGAGG - Intronic
1183730269 22:39614625-39614647 CAACCATGGTGGCCCAGCTGGGG + Intronic
1183975029 22:41507053-41507075 CTGCCATTTTGGCTCTGATGAGG + Intronic
950740968 3:15051691-15051713 GAGACATTGGGGCCCTGCTGGGG - Exonic
956669442 3:71672526-71672548 CAGCCCTTCTGGCTCTGATTAGG - Intergenic
959922721 3:111886368-111886390 AAGCCATTGTGGGCCTTGTGCGG - Intronic
961867778 3:129966540-129966562 CAGCCCCTGTGCCCCTTATGAGG - Intergenic
964402161 3:156310917-156310939 CAGCAATTAGGGCCCAGATGTGG + Intronic
972745083 4:41924562-41924584 AAGCCACTGTGGCTCTGCTGGGG + Intergenic
974754351 4:66184126-66184148 CTGCCACTGTGGCTTTGATGGGG + Intergenic
976294072 4:83452171-83452193 AAGCCATTCTGGGCCTCATGAGG - Intronic
979803919 4:124946990-124947012 CAGCTATTGGGGGGCTGATGTGG - Intergenic
990013509 5:51028652-51028674 CTACCACTGTGGCCATGATGAGG - Intergenic
992141092 5:73797834-73797856 CAGCACTTGTGTCACTGATGAGG - Intronic
993410456 5:87567260-87567282 GAGGCTTTGTGGCCCTGAGGTGG + Intergenic
995406064 5:111797751-111797773 CAACCATTAAGGCCCTGATGAGG + Intronic
996286598 5:121800991-121801013 CAGACATTGAGGCTCTCATGAGG - Intergenic
996916977 5:128723782-128723804 AAGCCATTGTGTACCTGATATGG + Intronic
997208481 5:132064278-132064300 CAGCCACTGTGGCACGGAGGTGG + Intergenic
999361124 5:150987642-150987664 CAGCCATTGCGGTCCTGACAGGG + Intergenic
999500814 5:152144767-152144789 AAGTCATTGAGTCCCTGATGCGG - Intergenic
1000253334 5:159515388-159515410 CAGGCATTGTGCCCTTAATGTGG + Intergenic
1003107979 6:3229681-3229703 CAGCCCTTTTGGCCGAGATGCGG - Intronic
1005419667 6:25635875-25635897 CAGCCATAGGGGCCATTATGTGG + Intergenic
1005438203 6:25837391-25837413 CAGCCATTGTGGCCCTGATGGGG + Intronic
1007753491 6:44083984-44084006 CAGCCACTGCTGCCCTGCTGGGG + Intergenic
1011797678 6:90975055-90975077 CAGCCATTAAGGCACTGAGGTGG + Intergenic
1015539142 6:134297067-134297089 CAGCCCTGGTGGAGCTGATGTGG + Intronic
1017415900 6:154220365-154220387 CAGCCATTGTTGACCAGGTGCGG + Intronic
1021395215 7:20139172-20139194 CAGCCTTAATGGCCCTAATGTGG + Exonic
1024181666 7:46901398-46901420 CTGCCATTGTGTTCCTGCTGCGG + Intergenic
1032159106 7:129497183-129497205 CAGCCAGTGGGGACCAGATGAGG + Intergenic
1034158966 7:148978451-148978473 CAGCCACCTGGGCCCTGATGTGG - Intergenic
1041148288 8:54903255-54903277 CAGTCACTGGGGCCATGATGTGG + Intergenic
1041465359 8:58152816-58152838 CAGCAAGTGAGGCCCTAATGGGG + Intronic
1041466395 8:58161669-58161691 CAGCCTTTCTGGGCCTGAGGTGG - Intronic
1041732518 8:61076919-61076941 CAGCCATTCTGTGCCTGTTGCGG + Intronic
1045192091 8:99893313-99893335 CAGCCATTGTGACCTTGGTGAGG - Intronic
1052384287 9:27806395-27806417 AAGCCATTGAGATCCTGATGGGG + Intergenic
1053144561 9:35703831-35703853 CAGCCTTCGTTGCACTGATGAGG + Exonic
1056116631 9:83447389-83447411 CATCCAGTGTGGCCCTGTTGGGG + Intronic
1057266210 9:93619699-93619721 CAGCCCTGGTGGGCCTGTTGCGG + Intronic
1062139992 9:134950737-134950759 CAGCCACTGTGGCAGTGACGGGG - Intergenic
1062195076 9:135268585-135268607 GAGCCACTGTGGCCCACATGTGG + Intergenic
1062454940 9:136631639-136631661 CATCCATGGTGGCCCTCCTGGGG - Intergenic
1062578130 9:137217965-137217987 CAGCCAGTGAGCCCCTGCTGGGG + Intergenic
1189244445 X:39552670-39552692 CAGCCATGGTTGACCTGATGGGG - Intergenic
1190731934 X:53232358-53232380 CAGCCATTGTGGGGATGAGGAGG + Intergenic
1195108808 X:101624849-101624871 CAGCTCTTGTGGCCTTGAAGTGG + Exonic
1198249982 X:134870525-134870547 CAGCCCTTGGGGCCCAGCTGAGG + Intergenic
1199074981 X:143516068-143516090 TAGCCATTGTAGCCCTGACAGGG - Intronic