ID: 1005443989

View in Genome Browser
Species Human (GRCh38)
Location 6:25902266-25902288
Sequence CTAGTTCCTCATTTCTCTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005443986_1005443989 -5 Left 1005443986 6:25902248-25902270 CCCACTTGGCCATGCTCTCTAGT No data
Right 1005443989 6:25902266-25902288 CTAGTTCCTCATTTCTCTCTTGG No data
1005443985_1005443989 -4 Left 1005443985 6:25902247-25902269 CCCCACTTGGCCATGCTCTCTAG No data
Right 1005443989 6:25902266-25902288 CTAGTTCCTCATTTCTCTCTTGG No data
1005443987_1005443989 -6 Left 1005443987 6:25902249-25902271 CCACTTGGCCATGCTCTCTAGTT No data
Right 1005443989 6:25902266-25902288 CTAGTTCCTCATTTCTCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005443989 Original CRISPR CTAGTTCCTCATTTCTCTCT TGG Intergenic
No off target data available for this crispr