ID: 1005445808

View in Genome Browser
Species Human (GRCh38)
Location 6:25921397-25921419
Sequence ATTGATACACAGAGGCCTGG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 207}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005445802_1005445808 -5 Left 1005445802 6:25921379-25921401 CCTGAGTTTCTGGGCTCCATTGA 0: 1
1: 0
2: 2
3: 34
4: 332
Right 1005445808 6:25921397-25921419 ATTGATACACAGAGGCCTGGGGG 0: 1
1: 0
2: 1
3: 16
4: 207
1005445801_1005445808 -4 Left 1005445801 6:25921378-25921400 CCCTGAGTTTCTGGGCTCCATTG 0: 1
1: 0
2: 6
3: 180
4: 1654
Right 1005445808 6:25921397-25921419 ATTGATACACAGAGGCCTGGGGG 0: 1
1: 0
2: 1
3: 16
4: 207
1005445797_1005445808 24 Left 1005445797 6:25921350-25921372 CCCATAGTTGATGGAGCTAAAGA 0: 1
1: 0
2: 0
3: 9
4: 85
Right 1005445808 6:25921397-25921419 ATTGATACACAGAGGCCTGGGGG 0: 1
1: 0
2: 1
3: 16
4: 207
1005445798_1005445808 23 Left 1005445798 6:25921351-25921373 CCATAGTTGATGGAGCTAAAGAT 0: 1
1: 0
2: 0
3: 12
4: 151
Right 1005445808 6:25921397-25921419 ATTGATACACAGAGGCCTGGGGG 0: 1
1: 0
2: 1
3: 16
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005445808 Original CRISPR ATTGATACACAGAGGCCTGG GGG Exonic
900554474 1:3272856-3272878 AAGGGGACACAGAGGCCTGGTGG + Intronic
901290068 1:8117165-8117187 ATGGTTCCCCAGAGGCCTGGAGG + Intergenic
906039943 1:42781001-42781023 ATGGAAAGAGAGAGGCCTGGTGG - Intronic
906579597 1:46925518-46925540 CTTGAAACCCAGGGGCCTGGTGG + Intergenic
906604127 1:47153369-47153391 CTTGAAACCCAGAGGCCTGGTGG - Intergenic
908940312 1:69424406-69424428 ATACATTGACAGAGGCCTGGGGG - Intergenic
912350130 1:109004683-109004705 GTTGATGCACAGAGGCCTATCGG - Exonic
912456924 1:109804153-109804175 AGTGATACACAGATCCCTTGGGG - Intergenic
913173128 1:116250069-116250091 ATTTATTCTCAGAGTCCTGGAGG - Intergenic
916614902 1:166429554-166429576 CTTGAAACCCAGAGCCCTGGTGG + Intergenic
916894030 1:169142878-169142900 ATTGATCCTCTGAGACCTGGAGG - Intronic
917009808 1:170458183-170458205 CTTGAAACCCAGAGCCCTGGTGG + Intergenic
919790356 1:201286503-201286525 ATTGAGCCACTGAGGACTGGAGG + Intronic
920847085 1:209603308-209603330 CTTCCTTCACAGAGGCCTGGTGG + Intronic
922091268 1:222397557-222397579 ATGGATACACTGGGCCCTGGTGG + Intergenic
1063247768 10:4240552-4240574 CTTGTTACAGAGATGCCTGGAGG - Intergenic
1064693641 10:17943589-17943611 ATTGGTATCAAGAGGCCTGGTGG - Intergenic
1064931588 10:20634446-20634468 ATTGAGACAAAGCAGCCTGGGGG + Intergenic
1065259166 10:23906988-23907010 ATTTATACACTGAGGGCTTGAGG + Intronic
1066457130 10:35582118-35582140 ATTGTTAAAAAGAGGTCTGGGGG + Intergenic
1068235040 10:54222486-54222508 ATTGATACACAGCAACTTGGAGG - Intronic
1068731797 10:60366455-60366477 ATTGTATCACAGAGACCTGGAGG - Intronic
1070942197 10:80357371-80357393 CTTGCTACACAGAAACCTGGAGG + Intronic
1071112192 10:82172742-82172764 ATTGAAACACAGAGGTCTGCGGG + Intronic
1071921528 10:90356124-90356146 GTTTATACAAAGAAGCCTGGGGG + Intergenic
1072854901 10:98936402-98936424 CTTGAGACCCAGGGGCCTGGTGG + Intronic
1072969943 10:100009254-100009276 TTTGAGACACAGATGCCCGGTGG + Intronic
1074985216 10:118652384-118652406 CTTGAAACCCAGAGCCCTGGTGG + Intergenic
1076469782 10:130710350-130710372 ATGGATTCACTGAGGCTTGGTGG + Intergenic
1077651855 11:3979893-3979915 ATTGATACAGACAGGGCTAGGGG - Intronic
1079264825 11:18921117-18921139 CTTGAAACCCAGAGCCCTGGTGG - Intergenic
1079267000 11:18943264-18943286 CTTGAAACCCAGAGCCCTGGTGG - Intergenic
1080770560 11:35337198-35337220 ATGGATACAGAGAGGCCTGTGGG - Intronic
1080942299 11:36932890-36932912 AATGAAACACATAGGCATGGTGG + Intergenic
1080977113 11:37356606-37356628 CTTGAAACACAGGGCCCTGGTGG - Intergenic
1084277082 11:68058350-68058372 ATTTCTACACAGAAGCCTGTGGG + Intronic
1084313350 11:68329594-68329616 ATGAAGACACTGAGGCCTGGAGG + Intronic
1090312651 11:125755949-125755971 CTTGAAACCCAGAGCCCTGGTGG - Intergenic
1094453251 12:30604178-30604200 CTTGAAACACAGGGCCCTGGTGG - Intergenic
1097685878 12:62690465-62690487 ATAGCTACACAGAGGCCTCAGGG + Intronic
1101753571 12:107603414-107603436 ATTGATAAACAGATGCCTTCTGG + Intronic
1102345619 12:112159294-112159316 CTTGAAACTCAGAGCCCTGGTGG + Intergenic
1102812600 12:115837483-115837505 ATTGATGTGCAGAGTCCTGGAGG + Intergenic
1104521109 12:129476197-129476219 ATGGACACACACATGCCTGGGGG - Intronic
1104731331 12:131107118-131107140 ATTGAGACACAGGGTTCTGGAGG - Intronic
1105452609 13:20513549-20513571 AGTGATAAACTGAGGCATGGAGG + Intronic
1107473499 13:40712958-40712980 CTTGAAACCCAGAGCCCTGGTGG + Intergenic
1109896616 13:68700067-68700089 ATTGATACCCATAGGACTGGGGG - Intergenic
1111017632 13:82402331-82402353 CTTGATACCCAGGGCCCTGGCGG - Intergenic
1111987136 13:95077015-95077037 CTTGAAACACAGTGGCCTGCTGG - Intronic
1112199434 13:97260752-97260774 GTGGTTAAACAGAGGCCTGGTGG + Intronic
1113250511 13:108447308-108447330 ATTAATCCACAGAAGCCAGGAGG + Intergenic
1114032118 14:18587043-18587065 GTTGATACACAGGGTCCAGGTGG - Intergenic
1114085263 14:19233495-19233517 GTTGATACACAGGGTCCAGGTGG + Intergenic
1114817621 14:25979194-25979216 ATTGAAACCCAGGGCCCTGGTGG - Intergenic
1115162372 14:30410521-30410543 CTTGAAACCCAGAGCCCTGGTGG + Intergenic
1115406347 14:33021336-33021358 ATTGAGACACAGAGGGCAGTTGG + Intronic
1116691404 14:48111387-48111409 ATTGATACACAGATGACTCTTGG + Intergenic
1117237928 14:53798242-53798264 ATTGAAACCCAGGGCCCTGGTGG - Intergenic
1117850111 14:59958730-59958752 CTTGAAACACAGAGCCCTGGTGG + Intronic
1121472492 14:94166109-94166131 ATTGGTAAACTGAGGCCTGGTGG + Intronic
1122093264 14:99353636-99353658 ATTTATACACAGAGGGCTTAAGG + Intergenic
1123069071 14:105632345-105632367 AGGGAGACACAGAGGACTGGGGG - Intergenic
1202896828 14_GL000194v1_random:15203-15225 GTTGATACACAGGGTCCAGGTGG + Intergenic
1124560702 15:30770917-30770939 CTTGACAGACAGAGGCATGGTGG + Intronic
1124670505 15:31634526-31634548 CTTGACAGACAGAGGCATGGTGG - Intronic
1125894734 15:43293108-43293130 ATTAAAAAACGGAGGCCTGGGGG - Intronic
1126790813 15:52219482-52219504 ACTGATACACAGAGGAGGGGAGG - Intronic
1128326581 15:66727700-66727722 ATTGATACACGGATGACTGTGGG + Intronic
1128739126 15:70071634-70071656 ATGGAGAAACTGAGGCCTGGAGG + Intronic
1128904025 15:71451598-71451620 CTTGGTAGACAGAGGCATGGGGG + Intronic
1132072731 15:98793750-98793772 ATTTATACCCAGAGGTCTGCAGG + Intronic
1134850252 16:17473094-17473116 ACTGATAAACAGATGACTGGTGG - Intergenic
1135807520 16:25556176-25556198 CTTGAAACCCAGAGCCCTGGTGG - Intergenic
1138527058 16:57614920-57614942 ACTGACTCACAGAGGCTTGGTGG + Intronic
1138959909 16:62016697-62016719 CTTGGTCCACAGAGGACTGGAGG + Intronic
1139416433 16:66814993-66815015 AGTGACACGCAGAGGTCTGGTGG - Intronic
1141950354 16:87335588-87335610 ATTGCTGCCCACAGGCCTGGTGG - Intronic
1149344610 17:55722039-55722061 TTTTATACACAAAGGCATGGAGG - Intronic
1149584337 17:57775286-57775308 AGTGTTCCACAGAGTCCTGGAGG - Intergenic
1152379725 17:79936149-79936171 ATTCACACACACATGCCTGGCGG + Exonic
1153161664 18:2212089-2212111 ATTGATACAGAATTGCCTGGGGG - Intergenic
1157471319 18:47991247-47991269 TTTGAAACACTGAGCCCTGGTGG + Intergenic
1157549374 18:48570728-48570750 CTTTATATGCAGAGGCCTGGAGG + Intronic
1159358848 18:67373823-67373845 AGTGATGCAAGGAGGCCTGGTGG + Intergenic
1160390128 18:78523748-78523770 ATTGATAAAGGGAGTCCTGGTGG + Intergenic
1161460605 19:4394719-4394741 ATTGATCAACAGAGGCCGGGAGG - Intronic
1162368145 19:10261977-10261999 AATGATACAGGCAGGCCTGGTGG + Intergenic
1162460626 19:10811999-10812021 ATAGACTCACAGAGGCCTGATGG - Intronic
1164702380 19:30295058-30295080 ATGTACACACAGAGCCCTGGGGG + Intronic
1166203481 19:41253673-41253695 ATTCATACACCGGGACCTGGCGG + Exonic
1167857847 19:52257034-52257056 ATGGGTACATAGTGGCCTGGGGG - Intergenic
928906789 2:36376919-36376941 AGTGATACACAGACACATGGGGG - Intronic
929898153 2:45979242-45979264 GTTGAGACACAAAGGCCGGGTGG - Intronic
932438442 2:71716884-71716906 AGTGATATCCAGAGGCCTGGAGG - Intergenic
935760661 2:106317587-106317609 ATCAATACAAAGTGGCCTGGGGG - Intergenic
937127834 2:119485495-119485517 ATTTATAAATAGAGGACTGGAGG - Intronic
938491500 2:131763583-131763605 GTTGATACACAGGGTCCAGGTGG - Intronic
938496065 2:131798758-131798780 GTTGATACACAGGGTCCAGGTGG + Intronic
941115057 2:161462503-161462525 CTTGAAACACAGGGTCCTGGTGG + Intronic
941829932 2:169944834-169944856 AATGATAGTCAGTGGCCTGGGGG + Intronic
941845244 2:170125931-170125953 CTTGATACCCAGGGCCCTGGTGG - Intergenic
944755494 2:202757282-202757304 ATTGACACACAGACGCCTGGTGG + Exonic
946114223 2:217447404-217447426 ATGGATATAAAGAGGCCTGATGG + Intronic
946848077 2:223878881-223878903 ATTTATAGAAAGAGGCCAGGTGG + Intronic
947780100 2:232752427-232752449 TTTGATACACAGATACATGGAGG - Intronic
948065421 2:235075137-235075159 TTTCATACCCAGAGTCCTGGAGG + Intergenic
948135573 2:235633665-235633687 AATGTTACACAGAGGCCAAGAGG - Intronic
1168887431 20:1269199-1269221 ATGGGCACACAGAGGCCTTGAGG - Intronic
1169002495 20:2178062-2178084 AATGACACACAGAGGGCTGTGGG - Intergenic
1172808815 20:37632695-37632717 ATTGAGAAACAGAGGCTTAGAGG - Intergenic
1174820376 20:53721692-53721714 GTTGCTACAGAGAGGCCAGGTGG - Intergenic
1175153191 20:56951534-56951556 ACTGATACACTCAGGCTTGGTGG + Intergenic
1176616516 21:9031199-9031221 GTTGATACACAGGGTCCAGGTGG + Intergenic
1176616536 21:9031309-9031331 ATTGACACACAGATACCAGGTGG + Intergenic
1176708613 21:10132433-10132455 GTTGATACACAGGGTCCAGGTGG - Intergenic
1177775931 21:25566027-25566049 ATTGAAACACAGGGGCCTTGAGG - Intergenic
1178785714 21:35651535-35651557 TTTGATACCCAGAAGGCTGGTGG - Intronic
1180292708 22:10859698-10859720 GTTGATACACAGGGTCCAGGTGG - Intergenic
1180456232 22:15514100-15514122 GTTGATACACAGGGTCCAGGTGG - Intergenic
1180495515 22:15889120-15889142 GTTGATACACAGGGTCCAGGTGG - Intergenic
1181816189 22:25438313-25438335 CTGCTTACACAGAGGCCTGGGGG - Intergenic
1183261679 22:36799348-36799370 AGTCAGACACAGAGGCCAGGAGG - Intergenic
949826535 3:8171330-8171352 ATTAGTACACAGAGGCCTGATGG + Intergenic
950350001 3:12340494-12340516 ATTGAAACACAGAGGGAAGGAGG - Intronic
950710331 3:14809481-14809503 ATTTCTCCACAGAAGCCTGGAGG + Intergenic
951093536 3:18601835-18601857 ATTTATACACACAGGTGTGGTGG + Intergenic
951468050 3:23023449-23023471 CTTGATTCTCAAAGGCCTGGAGG - Intergenic
951777297 3:26324182-26324204 GTTGAAACCCAGAGCCCTGGTGG + Intergenic
953854770 3:46492851-46492873 TTTGAGACACAGAGACCTAGGGG - Intergenic
954462898 3:50637846-50637868 ACCTAGACACAGAGGCCTGGGGG + Intronic
962765666 3:138560397-138560419 ATTGAAACCCAGGGCCCTGGTGG - Intronic
963093475 3:141509688-141509710 ATTGCTAGACAGTGTCCTGGAGG + Intronic
965017367 3:163174732-163174754 CTTGAAACCCAGAGCCCTGGTGG - Intergenic
965103119 3:164328464-164328486 ATGGACACACAGGGGCCTGTCGG + Intergenic
965511063 3:169568255-169568277 CTTGAAACTCAGAGCCCTGGTGG - Intronic
966251034 3:177865744-177865766 CTTGAAACCCAGAGCCCTGGTGG - Intergenic
966792551 3:183686966-183686988 ATTGAGAGACAGAGACCTTGAGG + Intergenic
967325158 3:188231349-188231371 ATTGATCCACAGAGGTGTGCTGG - Intronic
967715539 3:192758081-192758103 ATTGAAACCCAGGGCCCTGGTGG - Intronic
968273786 3:197424574-197424596 CTAGAGACACAGAGGCCCGGGGG - Intergenic
968578357 4:1378243-1378265 CCTGGTACACAGAGGGCTGGCGG + Intronic
969267032 4:6071343-6071365 CTTGAGACAGAGGGGCCTGGAGG + Intronic
971564828 4:28124765-28124787 ATTGAGACTCAGAGGTTTGGGGG - Intergenic
971901252 4:32661384-32661406 ATTGTTACACAGAGACCTAATGG - Intergenic
973321770 4:48817462-48817484 CTTGAAACCCAGGGGCCTGGTGG - Intronic
974298448 4:60034623-60034645 ATTGAAACCCGGAGCCCTGGTGG + Intergenic
975177862 4:71308744-71308766 CTTGAAACCCAGAGCCCTGGTGG - Intronic
976092591 4:81473202-81473224 AGTGAAACACAGAGGCTGGGTGG + Intronic
978362154 4:107942332-107942354 TTTTAAACACAGAGGTCTGGGGG - Intronic
981239004 4:142452066-142452088 AATCACACACAGAGGCCTGTCGG - Intronic
982733372 4:158979719-158979741 CTTGAAACACAGGGCCCTGGTGG - Intronic
982853002 4:160342582-160342604 CTTGAAACACAGGGCCCTGGTGG + Intergenic
983044559 4:162969977-162969999 CTTGAAACCCAGGGGCCTGGTGG + Intergenic
985706670 5:1405561-1405583 ACTGAACCACAGAGGCCTGGAGG - Intronic
988856567 5:35233286-35233308 AGTGCTGCAGAGAGGCCTGGAGG - Intergenic
989162851 5:38408438-38408460 AATGATACAAAAAGGTCTGGAGG + Intronic
989244369 5:39237422-39237444 ATTGATCCACTAAGGCCTTGGGG + Intronic
990351278 5:54919132-54919154 CTTGAAACCCAGAGCCCTGGTGG - Intergenic
990458360 5:56010616-56010638 ATGGAGACACAGAGGCTTGCGGG + Intergenic
990745900 5:58959192-58959214 CTTGATACCCAGGGCCCTGGTGG + Intergenic
991370710 5:65916586-65916608 ATACATACCCAGAAGCCTGGTGG + Intergenic
992287246 5:75248179-75248201 CTTGAAACCCAGAGCCCTGGTGG - Intergenic
994118066 5:96083357-96083379 GATGATACACTGAGGCCAGGTGG - Intergenic
995093955 5:108213401-108213423 CTTGAAACCCAGAGCCCTGGTGG + Intronic
995378650 5:111507775-111507797 ATTGAAACAAAGAGGACTGGAGG - Intronic
995785781 5:115826021-115826043 TTTGAAACCCAGAGCCCTGGGGG + Intergenic
996288195 5:121820189-121820211 ATTGCTACACAGGGCCCTTGTGG + Intergenic
996810845 5:127515071-127515093 TTTGAGACACAGAGACATGGGGG + Intergenic
1000660479 5:163932826-163932848 CTTGAAACCCAGAGCCCTGGTGG - Intergenic
1001791411 5:174460394-174460416 ATTGATATACAAAGGGCTGAGGG - Intergenic
1003982662 6:11404068-11404090 ATTGACAACCAGAGGCCTTGTGG - Intergenic
1005445808 6:25921397-25921419 ATTGATACACAGAGGCCTGGGGG + Exonic
1007108966 6:39302043-39302065 ATGGAGACACTGAGGCCTGGAGG - Intronic
1007195646 6:40057385-40057407 CTTGAAACACAGGGCCCTGGTGG + Intergenic
1008575513 6:52856663-52856685 CTTGAAACACAGGGCCCTGGTGG + Intronic
1008896883 6:56566303-56566325 CTTGAAACCCAGAGCCCTGGTGG + Intronic
1009572583 6:65406988-65407010 ATTTCTACACAGAAGCCTGCTGG + Intronic
1009752228 6:67888072-67888094 ATTGCTAGGCAGGGGCCTGGGGG + Intergenic
1009777152 6:68219078-68219100 TTTGATACCCAGAGCCCTGGTGG + Intergenic
1009797799 6:68494782-68494804 CTTGATACCCAGGGCCCTGGTGG - Intergenic
1009880463 6:69560479-69560501 CTTGAAACACAGGGCCCTGGTGG - Intergenic
1012264791 6:97128745-97128767 AAAGAAACAGAGAGGCCTGGTGG - Intronic
1012637013 6:101555886-101555908 ATTAATACACAGTGTCCTTGTGG - Intronic
1012841876 6:104339279-104339301 GGTGATGGACAGAGGCCTGGAGG - Intergenic
1018939612 6:168300351-168300373 ACTGACACAGAGAGGCCTTGTGG + Intronic
1019306385 7:337276-337298 ACTGTTTCACAGAGGCCAGGAGG - Intergenic
1020037756 7:4974829-4974851 AAGGATTCACAGAGCCCTGGCGG - Intergenic
1020874314 7:13674124-13674146 CTTGAAACCCAGAGCCCTGGTGG + Intergenic
1022692619 7:32671476-32671498 ACTGGGATACAGAGGCCTGGTGG - Intergenic
1022920293 7:35006016-35006038 ACTGAGATACAGAGGCCTGGTGG - Intronic
1038211534 8:25523064-25523086 CTTGAAACACAGGGCCCTGGTGG - Intergenic
1038676628 8:29628676-29628698 ATTGGTCCAGAGAGGCCTAGAGG - Intergenic
1039119510 8:34130122-34130144 GTAGATTCACAGAGGCCTTGAGG + Intergenic
1039284515 8:36026399-36026421 CTTGAAACACAGGGTCCTGGTGG - Intergenic
1039454244 8:37697089-37697111 AGTGAGACTCAGAGGCCTGCGGG - Intronic
1043137124 8:76542093-76542115 ATTTATCCAAAGAGGCCTCGTGG + Intergenic
1045751886 8:105495134-105495156 TTTGATAAACAGAAGACTGGTGG - Intronic
1047641133 8:126822672-126822694 AGAGATACACAGAGGCTTGTTGG - Intergenic
1048102208 8:131365088-131365110 ATTGATACACAGAGGACAGAGGG - Intergenic
1051060127 9:13036115-13036137 ATTGATACACAGAGACACAGAGG - Intergenic
1051298160 9:15618621-15618643 CTTGAAACACAGGGCCCTGGTGG + Intronic
1051611691 9:18967852-18967874 CTTGAAACCCAGAGCCCTGGTGG + Intronic
1051982868 9:23045734-23045756 TTTGAAACCCAGAGCCCTGGTGG - Intergenic
1053645581 9:40117928-40117950 GTTGATACACAGGGTCCAGGTGG - Intergenic
1053760129 9:41345581-41345603 GTTGATACACAGGGTCCAGGTGG + Intergenic
1054538992 9:66258044-66258066 GTTGATACACAGGGTCCAGGTGG + Intergenic
1058265754 9:102897450-102897472 CTTGAAACCCAGAGCCCTGGCGG - Intergenic
1059382940 9:113942517-113942539 ATGGATACAGAGAAGACTGGAGG - Intronic
1059450431 9:114368239-114368261 TTTGATCCACAGCAGCCTGGGGG - Intronic
1202793374 9_KI270719v1_random:101402-101424 GTTGATACACAGGGTCCAGGTGG - Intergenic
1186332865 X:8554472-8554494 CTTGAAACTCAGGGGCCTGGCGG - Intronic
1191762652 X:64662212-64662234 CTTGAAACACAGGGCCCTGGTGG + Intergenic
1192434000 X:71131437-71131459 ATTGAATCACAGACTCCTGGAGG - Intronic
1192931759 X:75814231-75814253 CTTGAAACACAGGGCCCTGGTGG - Intergenic
1192947620 X:75983156-75983178 GTTGAAACACAGAGGCCTATGGG + Intergenic
1193562619 X:83037826-83037848 CTTGAAACACAGGGCCCTGGTGG - Intergenic
1194515371 X:94845296-94845318 CTTGAAACCCAGAGCCCTGGTGG + Intergenic
1194954459 X:100162681-100162703 CTTGAAACCCAGAGCCCTGGTGG + Intergenic
1195810672 X:108825321-108825343 CTTGAAACCCAGAGCCCTGGTGG + Intergenic
1196022323 X:111003236-111003258 ATAGATACACAGAGACTGGGAGG + Intronic
1198062555 X:133061821-133061843 CTTGAAACCCAGGGGCCTGGTGG - Intronic
1200365458 X:155657724-155657746 CTTGAAACCCAGAGCCCTGGTGG + Intronic
1201149892 Y:11089922-11089944 GTTGATACACAGGGTCCAGGTGG + Intergenic
1201149913 Y:11090032-11090054 ATTGACACACAGGTGCCAGGTGG + Intergenic