ID: 1005452940

View in Genome Browser
Species Human (GRCh38)
Location 6:25991921-25991943
Sequence CCACATCTGGAGAGGGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005452940_1005452954 24 Left 1005452940 6:25991921-25991943 CCCACCTCCCTCTCCAGATGTGG No data
Right 1005452954 6:25991968-25991990 CAGTCACTCGAGCCACCCCTTGG No data
1005452940_1005452955 27 Left 1005452940 6:25991921-25991943 CCCACCTCCCTCTCCAGATGTGG No data
Right 1005452955 6:25991971-25991993 TCACTCGAGCCACCCCTTGGCGG No data
1005452940_1005452950 -4 Left 1005452940 6:25991921-25991943 CCCACCTCCCTCTCCAGATGTGG No data
Right 1005452950 6:25991940-25991962 GTGGGTCCTGGGAGCGTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005452940 Original CRISPR CCACATCTGGAGAGGGAGGT GGG (reversed) Intergenic
No off target data available for this crispr