ID: 1005456180

View in Genome Browser
Species Human (GRCh38)
Location 6:26021775-26021797
Sequence CGGGCCAGACGCCGGATGGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 69}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005456180_1005456192 29 Left 1005456180 6:26021775-26021797 CCGGCCATCCGGCGTCTGGCCCG 0: 1
1: 0
2: 0
3: 10
4: 69
Right 1005456192 6:26021827-26021849 TGATCTACGAGGAGACTCGCGGG 0: 1
1: 3
2: 0
3: 1
4: 30
1005456180_1005456189 4 Left 1005456180 6:26021775-26021797 CCGGCCATCCGGCGTCTGGCCCG 0: 1
1: 0
2: 0
3: 10
4: 69
Right 1005456189 6:26021802-26021824 GGCGGTGTGAAGCGGATCTCTGG 0: 1
1: 0
2: 4
3: 5
4: 46
1005456180_1005456193 30 Left 1005456180 6:26021775-26021797 CCGGCCATCCGGCGTCTGGCCCG 0: 1
1: 0
2: 0
3: 10
4: 69
Right 1005456193 6:26021828-26021850 GATCTACGAGGAGACTCGCGGGG 0: 1
1: 3
2: 0
3: 0
4: 11
1005456180_1005456190 18 Left 1005456180 6:26021775-26021797 CCGGCCATCCGGCGTCTGGCCCG 0: 1
1: 0
2: 0
3: 10
4: 69
Right 1005456190 6:26021816-26021838 GATCTCTGGTCTGATCTACGAGG 0: 1
1: 0
2: 0
3: 6
4: 37
1005456180_1005456187 -4 Left 1005456180 6:26021775-26021797 CCGGCCATCCGGCGTCTGGCCCG 0: 1
1: 0
2: 0
3: 10
4: 69
Right 1005456187 6:26021794-26021816 CCCGGCGTGGCGGTGTGAAGCGG 0: 1
1: 0
2: 0
3: 9
4: 93
1005456180_1005456191 28 Left 1005456180 6:26021775-26021797 CCGGCCATCCGGCGTCTGGCCCG 0: 1
1: 0
2: 0
3: 10
4: 69
Right 1005456191 6:26021826-26021848 CTGATCTACGAGGAGACTCGCGG 0: 1
1: 3
2: 3
3: 9
4: 31

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005456180 Original CRISPR CGGGCCAGACGCCGGATGGC CGG (reversed) Exonic
900142692 1:1145230-1145252 CGGGGCAGAGGCTGGATGGACGG - Intergenic
900568606 1:3347468-3347490 GGGACCAGACGCAGGAGGGCGGG - Intronic
900780637 1:4615255-4615277 CGGGGCAGGTGCCGGCTGGCAGG - Intergenic
901871294 1:12140578-12140600 CGGGGCAGACCCCTCATGGCCGG + Intronic
901875876 1:12166945-12166967 CGGGCCAGAGGCCAGGCGGCGGG - Intergenic
905853537 1:41291568-41291590 CGGGCCAGAGGCAGAAAGGCAGG - Intergenic
906204811 1:43981106-43981128 CAGGCCAGCAGCCGGATGCCCGG + Exonic
914665965 1:149832781-149832803 CGAGCTAGACGCCGAATGGCAGG - Intergenic
914669800 1:149861013-149861035 CGAGCTAGACGCCGAATGGCAGG + Exonic
1067216719 10:44310074-44310096 GGGGCCAGAGGCCGAATGGGAGG - Intergenic
1074772254 10:116742019-116742041 AGGGCCCGCCGCCGGGTGGCCGG - Intronic
1075419103 10:122287722-122287744 CTGGCCAGACCCTGGATTGCTGG + Intronic
1078507904 11:11965887-11965909 AGGTCCAGAAGCCGGCTGGCGGG + Exonic
1083619264 11:64040891-64040913 CTGGCCGGACGTCGGATGCCTGG - Intronic
1090117925 11:123994533-123994555 CAGGCTAGACGCAGCATGGCAGG + Exonic
1092259401 12:6944654-6944676 TGGGTCAGACGCGGGAAGGCGGG + Intronic
1092259406 12:6944673-6944695 CGGGTCAGACGCGGGAAGGCGGG + Intronic
1093077277 12:14770966-14770988 CGGGCGAGACGGCGAATCGCCGG + Exonic
1096122006 12:49094417-49094439 CGGGCCGGGGGCCGGTTGGCCGG - Exonic
1100260462 12:92928672-92928694 CGGGCCAGCCGCCGCCTGCCGGG - Intronic
1103779330 12:123388922-123388944 CGGGCCGGGCGCCGGACGGTGGG + Intronic
1105780502 13:23701862-23701884 AGGGCCAGGCGCAGGAGGGCTGG + Intergenic
1122144750 14:99682955-99682977 CGGGCCAGGCGCCGGGGGGATGG + Intergenic
1122632414 14:103113026-103113048 CGGGCCAGGGGCCGGCAGGCAGG - Intergenic
1122808861 14:104277776-104277798 CGGGACAGACCCCGGATGGACGG - Intergenic
1123110860 14:105866322-105866344 CTGGCCAGACGCGGGCTGGGTGG + Intergenic
1124453686 15:29821931-29821953 CGGGCCAGATGCCGGTGGGCGGG + Intronic
1133742327 16:8660954-8660976 CGGGCCAGAGTCCGGATCCCTGG - Intergenic
1142182483 16:88678080-88678102 CGGCACTGCCGCCGGATGGCTGG - Exonic
1143344874 17:6242150-6242172 CAGGCCAGAGGCCAGCTGGCGGG + Intergenic
1145794030 17:27645310-27645332 CAGGCCACACGCCGGGAGGCTGG - Exonic
1145808831 17:27752845-27752867 CAGGCCACACGCCGGGAGGCTGG - Intergenic
1146034002 17:29390549-29390571 CGGGCCGGCCGGCGGACGGCGGG - Intronic
1146674109 17:34761127-34761149 TGGGCCAGAGGATGGATGGCAGG + Intergenic
1147948401 17:44093240-44093262 GGGGCCAGACCCCCCATGGCAGG + Intronic
1152461260 17:80443693-80443715 CGGGCCCGAGGCCGAGTGGCAGG + Intergenic
1152598275 17:81248886-81248908 CGGGCCAGACGCCTGCCTGCAGG + Intronic
1160739113 19:677732-677754 CGGGCCAGAAGCTGGGTGTCAGG + Intronic
1161570084 19:5025664-5025686 GGCCCCAGAGGCCGGATGGCAGG - Intronic
1162363320 19:10232239-10232261 TGGGCCCGACGCTGGAAGGCAGG - Intergenic
1165448297 19:35868739-35868761 CCGGCCAGGCTCCCGATGGCGGG - Exonic
1166852416 19:45767011-45767033 CGGGCAAGGCGCGGGAGGGCCGG + Exonic
925306727 2:2851902-2851924 CGGGACTGACGCCAGAAGGCAGG + Intergenic
947636082 2:231681283-231681305 CGGGCCGGAAGCCGCAGGGCCGG - Intergenic
1175771477 20:61627315-61627337 CGGGCCTGAAGCCGGCAGGCAGG - Intronic
1176159859 20:63642469-63642491 CCGACCACAGGCCGGATGGCAGG - Intronic
1184857204 22:47152829-47152851 CGGGGGAGACGCAGGATGCCAGG + Intronic
961638519 3:128350008-128350030 GGTGCCAGACCCAGGATGGCTGG - Intronic
967173489 3:186842588-186842610 AGGGCCAGAGGCCGGTGGGCAGG - Intergenic
967929127 3:194677917-194677939 AGGGCCTGACTCCTGATGGCAGG + Intergenic
968801436 4:2745729-2745751 CAGGCCAGAGCCCGGATGGGAGG + Intronic
972348243 4:38211700-38211722 CGTGCCAGACGTTGGCTGGCTGG + Intergenic
980969656 4:139556579-139556601 CGGGCCGGAGGCGGGTTGGCTGG - Exonic
1002160727 5:177312551-177312573 GGGGACAGACCCCGGAGGGCAGG - Intronic
1005456180 6:26021775-26021797 CGGGCCAGACGCCGGATGGCCGG - Exonic
1005473930 6:26188958-26188980 CGAGCCAGGCGGCGGATAGCGGG + Exonic
1005475611 6:26204741-26204763 CGAGCAAGGCGCCGGATGGCAGG - Exonic
1005479315 6:26240522-26240544 CGGGCCAAGCGACGGATGGCGGG - Exonic
1005484329 6:26285381-26285403 CGAGCAAGGCGCCGGATAGCTGG + Exonic
1005570355 6:27139405-27139427 CGAGCAAGGCGCCGAATGGCTGG - Exonic
1005643987 6:27824221-27824243 CGAGCAAGGCGCCGGATGGCCGG - Exonic
1005645210 6:27831409-27831431 CGAGCAAGGCGCCGGATGGCCGG + Exonic
1005649465 6:27873392-27873414 CGTGCCAGGCGTCGGATGGCGGG + Exonic
1017714442 6:157198855-157198877 CGGGACAGCCGCCGTATGGAGGG + Exonic
1030033541 7:105389150-105389172 TGGGCCAGCCGCAGGATCGCAGG - Intronic
1040641243 8:49336359-49336381 GGGGCCGGACACAGGATGGCAGG + Intergenic
1049006526 8:139859127-139859149 CGGGCCAGAAACCGGGGGGCTGG - Intronic
1049215613 8:141406486-141406508 AGGGCCAGAGGCAGGAGGGCAGG - Intronic
1056773716 9:89497451-89497473 CCGGCCAGAGCCCGGCTGGCCGG + Intronic
1057594984 9:96408051-96408073 CGGGCCTGTCGCGGGGTGGCGGG + Intronic
1059414860 9:114156206-114156228 CGGGCCAGGCGCGGCAGGGCGGG - Intronic
1061458086 9:130713311-130713333 CGGCCCAGACAGCGGAAGGCGGG - Intergenic
1061690078 9:132320443-132320465 GGTGCCGGACGCCTGATGGCGGG + Intronic
1062308168 9:135921300-135921322 CGTCCCAGGAGCCGGATGGCTGG - Intergenic
1062352162 9:136144511-136144533 TGGGCCAGCAGCCGGAGGGCTGG + Intergenic
1189324810 X:40105855-40105877 CAGGCCAGAAGCCGGATCCCAGG - Intronic
1190879937 X:54484861-54484883 CTGGCCAGACGCTGGCTGGGTGG - Intronic
1196441460 X:115723199-115723221 CTGCCCAGAAGCCGGAGGGCAGG - Intergenic
1196444990 X:115841188-115841210 CTGCCCAGAAGCCGGAGGGCAGG - Intergenic
1200082866 X:153587802-153587824 CAGGCCTGCCGCCTGATGGCTGG + Intergenic