ID: 1005456184

View in Genome Browser
Species Human (GRCh38)
Location 6:26021783-26021805
Sequence CGCCACGCCGGGCCAGACGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 167}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005456184_1005456193 22 Left 1005456184 6:26021783-26021805 CCGGCGTCTGGCCCGGCGTGGCG 0: 1
1: 0
2: 0
3: 11
4: 167
Right 1005456193 6:26021828-26021850 GATCTACGAGGAGACTCGCGGGG 0: 1
1: 3
2: 0
3: 0
4: 11
1005456184_1005456189 -4 Left 1005456184 6:26021783-26021805 CCGGCGTCTGGCCCGGCGTGGCG 0: 1
1: 0
2: 0
3: 11
4: 167
Right 1005456189 6:26021802-26021824 GGCGGTGTGAAGCGGATCTCTGG 0: 1
1: 0
2: 4
3: 5
4: 46
1005456184_1005456190 10 Left 1005456184 6:26021783-26021805 CCGGCGTCTGGCCCGGCGTGGCG 0: 1
1: 0
2: 0
3: 11
4: 167
Right 1005456190 6:26021816-26021838 GATCTCTGGTCTGATCTACGAGG 0: 1
1: 0
2: 0
3: 6
4: 37
1005456184_1005456192 21 Left 1005456184 6:26021783-26021805 CCGGCGTCTGGCCCGGCGTGGCG 0: 1
1: 0
2: 0
3: 11
4: 167
Right 1005456192 6:26021827-26021849 TGATCTACGAGGAGACTCGCGGG 0: 1
1: 3
2: 0
3: 1
4: 30
1005456184_1005456191 20 Left 1005456184 6:26021783-26021805 CCGGCGTCTGGCCCGGCGTGGCG 0: 1
1: 0
2: 0
3: 11
4: 167
Right 1005456191 6:26021826-26021848 CTGATCTACGAGGAGACTCGCGG 0: 1
1: 3
2: 3
3: 9
4: 31

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005456184 Original CRISPR CGCCACGCCGGGCCAGACGC CGG (reversed) Exonic
900162120 1:1228773-1228795 CGCCACCCAGGGCCAGACCATGG + Exonic
900244530 1:1631142-1631164 CGTCACCCTGGGCCCGACGCCGG + Intergenic
900324750 1:2103139-2103161 CACCACGCCGGGCTAGACTGTGG + Intronic
902411549 1:16214741-16214763 CACCACGCCCGGCCAGACCTGGG - Intergenic
904339462 1:29824756-29824778 GGCCACCCCAGGCCAGAGGCAGG + Intergenic
905192326 1:36245006-36245028 CACCACGCCTGGCCAGAGCCAGG + Intronic
905201807 1:36321230-36321252 CGCCACGCCGGTCTGGTCGCTGG + Exonic
906637006 1:47416478-47416500 CGCCGCCCCGGGCCGGGCGCGGG - Exonic
914377556 1:147085438-147085460 CACCACGCCCGGCCAGAAACGGG + Intergenic
915490767 1:156248892-156248914 CACTACGCCTGGCCAGAGGCTGG + Intergenic
918349102 1:183635541-183635563 GGCCAGGCCGGGCCCGACGAGGG - Exonic
1063222264 10:3980001-3980023 CACCTCACCGGGCCAGAGGCAGG - Intergenic
1064017482 10:11783799-11783821 CGCCCCGCCCTGCCAGAGGCTGG - Intergenic
1073461592 10:103668748-103668770 CGCCGCGCTCGGCCAGCCGCGGG + Intronic
1074506384 10:114074578-114074600 CACCACGCCCGGCCACATGCAGG + Intergenic
1075907240 10:126092351-126092373 CGCTATGCTGGGCCACACGCTGG - Intronic
1076405808 10:130211997-130212019 AGCCACTCCGGGCCAGAGGCTGG - Intergenic
1076792707 10:132785583-132785605 CACCACGCCGGGCCAGAAGATGG + Exonic
1077502149 11:2914286-2914308 CACCACGACCTGCCAGACGCAGG - Intronic
1078800904 11:14643681-14643703 CGCCCGGCCGGGGCAGTCGCGGG + Intergenic
1079205637 11:18412243-18412265 CCCCCCGCCGGCCCAGGCGCGGG - Intergenic
1080862398 11:36161081-36161103 CACCGCGCCTGGCCAGAAGCAGG + Intronic
1083033571 11:59615774-59615796 CGCCCCGCCCGGCCAGCCGCGGG + Exonic
1084936620 11:72590320-72590342 CTCCGCGCCGGGCCCGCCGCCGG + Intronic
1085565408 11:77508980-77509002 CACCGCGCCCGGCCAGATGCTGG - Intergenic
1092298514 12:7222508-7222530 CACCACGCCCGGCCACAGGCAGG + Intergenic
1095097952 12:38158029-38158051 GACCACCCCGGGCCTGACGCAGG - Intergenic
1095741459 12:45611228-45611250 CGCCTCGCCGGGGCTGAGGCTGG + Intergenic
1100391657 12:94149744-94149766 CGCCATGCTGGGCCAGCCGGTGG - Exonic
1103122876 12:118395512-118395534 CACCACGCCCGGCCAGAATCAGG + Intronic
1103413012 12:120725968-120725990 CCGCCCGCTGGGCCAGACGCGGG - Intronic
1103971822 12:124677373-124677395 CGCCACCTCGGGACAGAGGCAGG + Intergenic
1105277367 13:18943841-18943863 GGACACGCCGGGCCGGGCGCAGG + Intergenic
1105472126 13:20703868-20703890 CGCCCCGCGGAGCCAGAGGCCGG - Intronic
1105953185 13:25252362-25252384 CGCCACTACGGCCCAGACGTGGG - Intronic
1107467563 13:40664876-40664898 CGCCCCGCGCGGCCAGGCGCCGG + Intronic
1112079890 13:95958437-95958459 CTCCACGCCTGGCCAAAGGCAGG + Intronic
1114497725 14:23145238-23145260 CACCATGCCCGGCCAGAAGCAGG - Intronic
1122834267 14:104423425-104423447 CCCCTCGCTGGGCCAGACCCTGG - Intergenic
1123106060 14:105841599-105841621 GGCCACACCTGGCCAGAAGCTGG - Intergenic
1124183293 15:27498792-27498814 CACCACGCCCGGCCAGATGTGGG + Intronic
1124629356 15:31327938-31327960 CGACGCGCGGGGCCAGCCGCGGG - Intronic
1124884028 15:33667773-33667795 CACCGCGCCGGGCCTGACTCAGG - Intronic
1125698642 15:41660653-41660675 CGCCAGGCCGGGCCTTGCGCAGG + Intronic
1128289186 15:66463770-66463792 CACCACGCCTGGCCAGAGGTTGG + Intronic
1128968412 15:72085104-72085126 CACCACGCCCGGCCAGCTGCAGG - Intronic
1129164528 15:73768801-73768823 CACCACGCCCGGCCAAAAGCTGG - Intergenic
1129202205 15:74009839-74009861 CACCACGCCCAGCCAGAAGCAGG + Intronic
1129913695 15:79249125-79249147 CACCGCGCCTGGCCAGAAGCTGG + Intergenic
1130370888 15:83284593-83284615 CGCCGAGCCGGGGCGGACGCGGG - Exonic
1132369058 15:101280567-101280589 CACCACGCCTGGCCAAACTCAGG - Intergenic
1132569088 16:636206-636228 CGCCACGCTGGGCCGGATCCAGG + Exonic
1133784468 16:8963683-8963705 CGCCGCGCCCGGCCCGAGGCGGG - Intronic
1135040510 16:19114135-19114157 AGCCAGGCCGGGCCAGAAGCTGG + Intronic
1139589132 16:67923619-67923641 CTCCACGTCGGCCCAGAAGCAGG + Intronic
1142560696 17:807351-807373 TCCCACGCCGGGGCACACGCAGG - Intronic
1142757281 17:2023907-2023929 CTCCTGGCCGGGCCAGGCGCGGG + Intronic
1143513328 17:7407469-7407491 CCCCACCCCAGGCCAGACTCAGG - Intronic
1143595972 17:7914254-7914276 CACCGCGCCGGGCCAGACTCTGG - Intergenic
1146896384 17:36544982-36545004 GCCCACGCCGGCCCTGACGCGGG + Exonic
1147590961 17:41683027-41683049 CGCCACGCCCGGCCTGACATGGG - Intergenic
1148106456 17:45121361-45121383 CGCCCCGCCAGGCCTGACGGAGG - Exonic
1148782525 17:50129907-50129929 CGCCAGGCCTGGCCGGACGCGGG + Intergenic
1151875950 17:76868450-76868472 CGTCGCGCGGGGCCGGACGCCGG + Intronic
1152640118 17:81445781-81445803 CGCCACACCTGCCCAGACCCAGG + Intronic
1152817788 17:82418499-82418521 CGCGGAGCCGGGCCGGACGCGGG + Exonic
1154209559 18:12367878-12367900 CACCGCGCCCGGCCAGAGGCAGG - Intronic
1157354137 18:46917625-46917647 CAGCACGCCGGGGCAGGCGCGGG - Intronic
1157541617 18:48514923-48514945 CCCCACGCTGGGCCAGCTGCAGG - Intergenic
1159770817 18:72543716-72543738 CGCTGAGCCGGGCGAGACGCGGG - Intronic
1161086891 19:2339581-2339603 CACTAGGCCGGGCCAGAGGCTGG - Intronic
1162328116 19:10010538-10010560 AGCCCCGCCTGGCCAGGCGCTGG - Intergenic
1162518005 19:11161419-11161441 CACCACGCCCGGCCAGAGACAGG + Intergenic
1163123920 19:15233774-15233796 CACCGCGCCTGGCCAGAAGCTGG - Intergenic
1165104814 19:33462486-33462508 CGCCACGGCTGGGCAGCCGCCGG + Intronic
1166748329 19:45152474-45152496 CCCCACGCCGCGCCAGGCGGTGG - Exonic
1166826801 19:45614905-45614927 CACCATGCCCGGCCAGATGCGGG - Intronic
925388282 2:3478730-3478752 GGCCACACAGGGCCATACGCTGG + Intronic
926617634 2:15013144-15013166 CACCACGCCTGGCCAGACTGAGG + Intergenic
931649417 2:64454527-64454549 CGCCGCGCCGGGCAAGAAGATGG + Exonic
934678436 2:96265961-96265983 CGCAACGCCCGGACAGACCCGGG + Exonic
937820861 2:126308570-126308592 CACCGCGCCTGGCCAGAAGCAGG - Intergenic
945833110 2:214809675-214809697 CGGCCCGCCGTCCCAGACGCGGG - Exonic
947461600 2:230308565-230308587 CGCCACGCAGGGCCACATGGGGG + Intronic
947914863 2:233824549-233824571 AGCCACACAGGGCCAGGCGCAGG + Intronic
1169486754 20:6041108-6041130 CTGCAGGCGGGGCCAGACGCTGG - Exonic
1173243367 20:41317377-41317399 CGCCACGCCTGGCCCGCGGCCGG - Intronic
1173649383 20:44653276-44653298 CACCACGCCTGGCCACACACAGG + Intergenic
1174365702 20:50055047-50055069 CGCCACCCCGAGCCACACGCCGG - Intergenic
1178557318 21:33604077-33604099 CACCACGCCCGGCCAGAGACGGG - Intronic
1180549731 22:16529803-16529825 CGCCAGTCCAGGGCAGACGCAGG - Intergenic
1180620548 22:17159072-17159094 CGCCACTCAGGGCCGGAGGCGGG - Intronic
1180659561 22:17454304-17454326 CACCACGCCTGGCCAGCTGCAGG - Intronic
1182470014 22:30542636-30542658 CGCCACTCCTGACCAGGCGCAGG - Intronic
1185055257 22:48575853-48575875 CGCCGCGGCGGGCCAGGCTCGGG - Intronic
954068309 3:48124624-48124646 GGCCAGGCCAGGCCAGATGCTGG - Intergenic
954838715 3:53493911-53493933 CGCGACGCCAGGCCAGGCGCAGG + Intergenic
954838925 3:53494615-53494637 CGCCGCGCCGCGCCGCACGCCGG - Intergenic
956594231 3:70948795-70948817 CACCACACCCGGCCCGACGCTGG - Intergenic
956867449 3:73384000-73384022 CCCCACGCCCAGCCAGAAGCTGG - Exonic
960658155 3:120028843-120028865 CGCCACGGCTGCTCAGACGCAGG + Intronic
961101369 3:124201972-124201994 GGCCAGGCTGGGCCAGATGCTGG + Intronic
961402664 3:126658091-126658113 GGCCAGGCTGGGCCAGATGCTGG + Intergenic
966974371 3:185071586-185071608 CGCCCCGCCTGGCCAGAAGATGG - Intergenic
968228891 3:196992711-196992733 TGCCAGGCTGGGGCAGACGCAGG - Intronic
968433973 4:575744-575766 GGCCACGCCGGGCGAGTCGGGGG - Intergenic
968514433 4:1010346-1010368 GCCCACGCTGGCCCAGACGCGGG + Intronic
972396454 4:38663530-38663552 CGCCGCGCCGCGCCGGCCGCGGG + Intergenic
972588371 4:40460042-40460064 CACCACGCCTGGCCAGGAGCTGG + Intronic
972628566 4:40823912-40823934 CACTACGCCCGGCCAGAAGCTGG - Intronic
976303616 4:83537741-83537763 CCCCACGCCTGGCCAGAAACAGG + Intronic
978503453 4:109433518-109433540 CGGAACCCCGGGCCAGACTCAGG + Intergenic
979134023 4:117085631-117085653 CGCAACCCCGGGCCTGGCGCCGG - Intergenic
988454574 5:31375786-31375808 CACCACGCCTGGCCTGAGGCAGG + Intergenic
993585707 5:89725121-89725143 GGCCATGCCTGGCCAGAAGCAGG + Intergenic
993991669 5:94665460-94665482 CACCACGCCCGGCCTAACGCTGG - Intronic
998039859 5:138945156-138945178 CCACACCCCGGGCCAGACCCTGG + Intergenic
1000330724 5:160203188-160203210 CACCACGCCCTGCCAGAAGCTGG + Intronic
1001397365 5:171426918-171426940 CACCACGCCCGGCCAGAAGTAGG - Intronic
1005456184 6:26021783-26021805 CGCCACGCCGGGCCAGACGCCGG - Exonic
1005480017 6:26246851-26246873 CGCCATGCCGGGCCAAGCGCCGG + Exonic
1005649460 6:27873384-27873406 CTCCACGCCGTGCCAGGCGTCGG + Exonic
1006148314 6:31972182-31972204 CGCCAGGCCGGGCCCCACGCCGG - Exonic
1011527011 6:88276462-88276484 CGCCAGCCAGGTCCAGACGCAGG + Intergenic
1011601605 6:89065128-89065150 CGCCCCGCCTGGCCAGGGGCAGG - Intergenic
1012186033 6:96218181-96218203 CACCACGCCTGGCCAGAAGGTGG + Intergenic
1019404600 7:876966-876988 GGCCACACAGGGCCAGACCCCGG - Intronic
1020011785 7:4809249-4809271 CGCCAAGCTGGGCGAGAGGCCGG + Intronic
1022447028 7:30478906-30478928 CGCCCCCCCGCGCCAGACCCGGG - Intergenic
1023706290 7:42945187-42945209 CCCCACGCCTGGCCACAAGCAGG + Intronic
1026814450 7:73499472-73499494 CACCATGCCCGGCCAGACCCAGG + Intronic
1027333253 7:77121932-77121954 CGGCGCGCCGGGCCAGGCGGAGG + Intergenic
1028888448 7:95960393-95960415 CACCACGCCCGGCCAAATGCTGG + Intronic
1032780897 7:135164678-135164700 CGCCAAGCCTGGCCAGGCCCAGG - Exonic
1034715708 7:153239442-153239464 CACCACGCAGGGCCACACGAGGG + Intergenic
1035127250 7:156617139-156617161 GGCCATGCCGGGACTGACGCAGG + Intergenic
1035378794 7:158425243-158425265 CGCACCGCCGGGAAAGACGCGGG + Intronic
1035378827 7:158425393-158425415 CGCACCGCCGGGAAAGACGCGGG + Intronic
1035378851 7:158425493-158425515 CGCACCGCCGGGAAAGACGCGGG + Intronic
1035378863 7:158425543-158425565 CGCACCGCCGGGAAAGACGCGGG + Intronic
1035378886 7:158425643-158425665 CGCACCGCCGGGAAAGACGCGGG + Intronic
1035378907 7:158425743-158425765 CGCACCGCCGGGAAAGACGCGGG + Intronic
1035378918 7:158425793-158425815 CGCACCGCCGGGAAAGACGCGGG + Intronic
1035378930 7:158425843-158425865 CGCACCGCCGGGAAAGACGCGGG + Intronic
1035378973 7:158426041-158426063 CGCACCGCCGGGAAAGACGCGGG + Intronic
1035378995 7:158426141-158426163 CGCACCGCCGGGAAAGACGCGGG + Intronic
1035379017 7:158426241-158426263 CGCACCGCCGGGAAAGACGCGGG + Intronic
1035379048 7:158426391-158426413 CGCACCGCCGGGAAAGACGCGGG + Intronic
1035379070 7:158426491-158426513 CGCACCGCCGGGAAAGACGCGGG + Intronic
1035379082 7:158426541-158426563 CGCACCGCCGGGAAAGACGCGGG + Intronic
1035379105 7:158426641-158426663 CGCACCGCCGGGAAAGACGCGGG + Intronic
1035379127 7:158426741-158426763 CGCACCGCCGGGAAAGACGCGGG + Intronic
1035379149 7:158426841-158426863 CGCACCGCCGGGAAAGACGCGGG + Intronic
1035379180 7:158426991-158427013 CGCACCGCCGGGAAAGACGCGGG + Intronic
1035379247 7:158427290-158427312 CGCACCGCCGGGAAAGACGCGGG + Intronic
1035379280 7:158427440-158427462 CGCACCGCCGGGAAAGACGCGGG + Intronic
1035379292 7:158427490-158427512 CGCACCGCCGGGAAAGACGCGGG + Intronic
1035379315 7:158427590-158427612 CGCACCGCCGGGAAAGACGCGGG + Intronic
1035379338 7:158427690-158427712 CGCACCGCCGGGAAAGACGCGGG + Intronic
1035379360 7:158427790-158427812 CGCACCGCCGGGAAAGACGCGGG + Intronic
1035379383 7:158427890-158427912 CGCACCGCCGGGAAAGACGCGGG + Intronic
1035379395 7:158427940-158427962 CGCACCGCCGGGAAAGACGCGGG + Intronic
1035476291 7:159145727-159145749 CGCCCCGCCGCGCCCCACGCGGG + Intergenic
1037274928 8:17167582-17167604 CACCACGCCCGGCCACAAGCTGG + Intronic
1047558966 8:125965794-125965816 CGCCACTCTGTGCCAGACACAGG - Intergenic
1048321535 8:133404130-133404152 GGCCAGGCCAGGCCAGACTCTGG + Intergenic
1048672295 8:136736728-136736750 CGCCATGCAGGGCCACACGTGGG + Intergenic
1051170326 9:14314346-14314368 CGCTCGGCCGGGTCAGACGCGGG - Intronic
1052965975 9:34340963-34340985 CACCACGCCTGGCCAGAAGCGGG + Intronic
1060173127 9:121477954-121477976 AGCCAGGCCAGGCCAGACCCTGG + Intergenic
1062458854 9:136654433-136654455 CACCACGCCCGGCCAGCGGCAGG - Intergenic
1062519074 9:136950186-136950208 CCCCACCGCGGGGCAGACGCAGG - Intronic
1062539643 9:137035861-137035883 CGCCTCCCAGGGCCAGAAGCTGG + Exonic
1189262552 X:39688941-39688963 CGCGCCGCCGGGCCAGACAAAGG - Intergenic
1190211644 X:48453285-48453307 CACCACGCCCAGCCAGATGCTGG + Intergenic
1192266024 X:69538640-69538662 CGACCAGCCGGGCCAGAGGCAGG + Intergenic
1192530007 X:71875640-71875662 CGCCACGCCGGGCCAAAGTTAGG - Intergenic
1200217540 X:154374690-154374712 CGCCGGGCCGGGCCGGGCGCGGG - Intergenic
1201696640 Y:16833837-16833859 CGCCAGGCCAGGCAAAACGCTGG + Intergenic