ID: 1005456186

View in Genome Browser
Species Human (GRCh38)
Location 6:26021794-26021816
Sequence CCGCTTCACACCGCCACGCC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1352
Summary {0: 1, 1: 0, 2: 0, 3: 55, 4: 1296}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005456186_1005456195 29 Left 1005456186 6:26021794-26021816 CCCGGCGTGGCGGTGTGAAGCGG 0: 1
1: 0
2: 0
3: 55
4: 1296
Right 1005456195 6:26021846-26021868 CGGGGTGCTCAAGGTGTTTTTGG 0: 1
1: 0
2: 0
3: 5
4: 81
1005456186_1005456192 10 Left 1005456186 6:26021794-26021816 CCCGGCGTGGCGGTGTGAAGCGG 0: 1
1: 0
2: 0
3: 55
4: 1296
Right 1005456192 6:26021827-26021849 TGATCTACGAGGAGACTCGCGGG 0: 1
1: 3
2: 0
3: 1
4: 30
1005456186_1005456193 11 Left 1005456186 6:26021794-26021816 CCCGGCGTGGCGGTGTGAAGCGG 0: 1
1: 0
2: 0
3: 55
4: 1296
Right 1005456193 6:26021828-26021850 GATCTACGAGGAGACTCGCGGGG 0: 1
1: 3
2: 0
3: 0
4: 11
1005456186_1005456191 9 Left 1005456186 6:26021794-26021816 CCCGGCGTGGCGGTGTGAAGCGG 0: 1
1: 0
2: 0
3: 55
4: 1296
Right 1005456191 6:26021826-26021848 CTGATCTACGAGGAGACTCGCGG 0: 1
1: 3
2: 3
3: 9
4: 31
1005456186_1005456194 20 Left 1005456186 6:26021794-26021816 CCCGGCGTGGCGGTGTGAAGCGG 0: 1
1: 0
2: 0
3: 55
4: 1296
Right 1005456194 6:26021837-26021859 GGAGACTCGCGGGGTGCTCAAGG 0: 1
1: 2
2: 2
3: 7
4: 89
1005456186_1005456190 -1 Left 1005456186 6:26021794-26021816 CCCGGCGTGGCGGTGTGAAGCGG 0: 1
1: 0
2: 0
3: 55
4: 1296
Right 1005456190 6:26021816-26021838 GATCTCTGGTCTGATCTACGAGG 0: 1
1: 0
2: 0
3: 6
4: 37

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005456186 Original CRISPR CCGCTTCACACCGCCACGCC GGG (reversed) Exonic
900034500 1:395852-395874 CAGGTACACACCACCACGCCTGG + Intergenic
900055333 1:625740-625762 CAGGTACACACCACCACGCCTGG + Intergenic
900281799 1:1874462-1874484 CAGGTGCACACCGCCACGCCCGG - Intronic
900673660 1:3870812-3870834 CTGCTTCCCACTGCCATGCCCGG - Intronic
900728189 1:4232523-4232545 CAGGTCCACACCGCCACACCAGG - Intergenic
900817122 1:4856891-4856913 CTGCTTCACACAGCCATGCAGGG - Intergenic
901518126 1:9763102-9763124 CAGGTGCACACCACCACGCCTGG + Intronic
901600936 1:10422884-10422906 CAGGTGCACACCGCCACGCCTGG + Intergenic
901694816 1:10999057-10999079 CAGCTGCCCACCACCACGCCTGG - Intergenic
901729726 1:11270710-11270732 CGGGTGCACACTGCCACGCCTGG + Intergenic
901793411 1:11666522-11666544 CAGGTGCACACCACCACGCCTGG + Intronic
901799039 1:11696708-11696730 CAGGTGCACACCACCACGCCCGG - Intronic
901877688 1:12176074-12176096 CAGGTGCACACCACCACGCCTGG - Intronic
902114699 1:14111880-14111902 CAGCTGCGCACCACCACGCCCGG + Intergenic
902327104 1:15708357-15708379 CAGGTGCACACCACCACGCCCGG + Intronic
902426133 1:16323645-16323667 CAGGTGCACACCACCACGCCTGG - Intronic
902426715 1:16329439-16329461 CAGGCGCACACCGCCACGCCTGG - Intronic
902875263 1:19337247-19337269 CAGGTGCACACCACCACGCCTGG + Intergenic
903511514 1:23879149-23879171 CAGGTGCACACCACCACGCCTGG - Intronic
903636509 1:24821692-24821714 CAGGTGCACACCACCACGCCTGG + Intronic
903652339 1:24929814-24929836 CCGCTTCACACCTCCCTCCCCGG - Exonic
903915273 1:26759343-26759365 CAGCTGCACACCACCACACCTGG + Intronic
904188370 1:28723658-28723680 CAGGTGCACACCACCACGCCTGG - Intergenic
904221116 1:28969756-28969778 CAGGTGCCCACCGCCACGCCCGG - Intronic
904653798 1:32026935-32026957 CAGGTGCACACCACCACGCCTGG + Intronic
904653987 1:32028643-32028665 CAGGTGCCCACCGCCACGCCCGG + Intronic
904658347 1:32066232-32066254 CAGGTGCACACCGCCATGCCAGG + Intergenic
904665975 1:32121828-32121850 CAGGTACACACCACCACGCCCGG - Intronic
904830675 1:33304635-33304657 CAGGTGCCCACCGCCACGCCTGG + Intergenic
904863060 1:33554334-33554356 CAGGTGCACACCACCACGCCTGG + Intronic
904939406 1:34154868-34154890 CAGGTGCACACCACCACGCCTGG + Intronic
905393719 1:37653993-37654015 CAGGTGCACACCACCACGCCTGG - Intergenic
905402016 1:37710656-37710678 CAGGTGCACACCACCACGCCTGG + Intergenic
905564297 1:38951435-38951457 CAGGCTCCCACCGCCACGCCCGG + Intergenic
905938278 1:41841948-41841970 CAGGTGCACACCACCACGCCTGG - Intronic
905976507 1:42178640-42178662 CAGGTGCACACCGCCATGCCTGG - Exonic
906063762 1:42965169-42965191 CAGGTGCACACCACCACGCCTGG - Intergenic
906217325 1:44050772-44050794 CAGGTGCACACCACCACGCCTGG - Intergenic
906272520 1:44491804-44491826 CAGGTGCACACCACCACGCCCGG + Intronic
906584244 1:46962257-46962279 CAGGTGCACACTGCCACGCCTGG + Intergenic
906970661 1:50510024-50510046 CAGGTGCACACCGCCACACCCGG - Intronic
906992356 1:50752823-50752845 CAGGTACACACCGCCACACCTGG + Intronic
907025164 1:51110824-51110846 CAGGTGCACACCACCACGCCAGG - Intronic
907214010 1:52846988-52847010 CGGGTACACGCCGCCACGCCTGG + Intronic
907358433 1:53895278-53895300 CAGGTGCACACCACCACGCCTGG - Intronic
907443951 1:54495725-54495747 CAGGTGCACACCACCACGCCCGG - Intergenic
907774392 1:57499116-57499138 CAGATGCACACCACCACGCCCGG + Intronic
908234406 1:62136173-62136195 CAGGCTCACACCGCCACGCCCGG + Intronic
908514720 1:64880802-64880824 CAGGTGCACACCACCACGCCTGG - Intronic
908536681 1:65084791-65084813 CAGGTGCACACCACCACGCCCGG + Intergenic
908550459 1:65203659-65203681 CAGGTGCACACCACCACGCCTGG - Intronic
909394018 1:75149688-75149710 CAGTTGCACACCACCACGCCTGG + Intronic
909462473 1:75933373-75933395 CAGGTGCACACCACCACGCCCGG + Intergenic
909614623 1:77592442-77592464 CAGGTGCACACCACCACGCCTGG + Intronic
909621867 1:77677193-77677215 CAGATGCACACCACCACGCCCGG - Intronic
910182409 1:84499950-84499972 CAGGTGCACACCACCACGCCCGG - Intronic
910765977 1:90782698-90782720 CAGGTGCACACCACCACGCCAGG + Intergenic
910964939 1:92799006-92799028 CAGGTGCACACCACCACGCCCGG - Intergenic
911190956 1:94947974-94947996 CAGGTGCACACCACCACGCCTGG - Intergenic
911347038 1:96709560-96709582 CAGGTACACACCACCACGCCTGG + Intergenic
911700236 1:100944189-100944211 CAGGTGCACACCACCACGCCTGG + Intronic
911956763 1:104246050-104246072 CAGGTGCACACCACCACGCCCGG + Intergenic
912422343 1:109552017-109552039 CAGGTGCACACCACCACGCCCGG - Intronic
912545014 1:110444461-110444483 CAGGTGCACACCACCACGCCTGG - Intergenic
912697976 1:111855695-111855717 CTGCTGCACACCTCCACCCCAGG + Intronic
912780102 1:112538483-112538505 CAGGTGCACACCACCACGCCTGG + Intronic
912842787 1:113053466-113053488 CAGGTGCACACCACCACGCCCGG - Intergenic
912846348 1:113078379-113078401 CCGGTGCCCACCACCACGCCAGG + Intronic
912850354 1:113118805-113118827 CCGGTGCACGCCACCACGCCTGG + Intronic
912979341 1:114356543-114356565 CAGGTGCACACCACCACGCCTGG - Intergenic
913162849 1:116161032-116161054 CAGGTGCACACCACCACGCCTGG - Intergenic
914229693 1:145754494-145754516 CAGATGCACACCACCACGCCTGG + Intronic
914576760 1:148978723-148978745 CAGGTGCACACCACCACGCCCGG + Intronic
914828029 1:151149606-151149628 CAGGCGCACACCGCCACGCCCGG - Intergenic
915229917 1:154437854-154437876 CAGGTGCACACCACCACGCCCGG + Intronic
915293365 1:154901438-154901460 CAGGCGCACACCGCCACGCCCGG + Intergenic
915350852 1:155224596-155224618 CAGTCGCACACCGCCACGCCTGG - Intergenic
915389959 1:155533569-155533591 CAGGTGCACACCACCACGCCTGG - Intronic
915395487 1:155580390-155580412 CAGGTGCACACCACCACGCCTGG - Intergenic
916052115 1:161043764-161043786 CAGGTGCACACCACCACGCCTGG + Intronic
916054468 1:161058716-161058738 CAGATGCACACCACCACGCCTGG - Intronic
916536115 1:165704820-165704842 CAGGTGCACACCACCACGCCTGG - Intergenic
916547780 1:165822709-165822731 CAGGTGCACACCACCACGCCCGG - Intronic
916653941 1:166856190-166856212 CAGATTCACACCACCATGCCCGG - Intronic
916702143 1:167308207-167308229 CAGGTGCACACCACCACGCCTGG + Intronic
917109320 1:171528945-171528967 CAGGTGCACACCACCACGCCAGG + Intronic
917289374 1:173456540-173456562 CAGGTGCACACCACCACGCCTGG + Intergenic
917366793 1:174240387-174240409 CCGGTTCCCACCGCCATGCCTGG + Intronic
917551088 1:176030092-176030114 CAGATGCACACCACCACGCCTGG + Intronic
917684324 1:177400493-177400515 CAGATGCACACCACCACGCCTGG + Intergenic
917763938 1:178197464-178197486 CAGGTGCACACCACCACGCCTGG - Intronic
917839717 1:178967904-178967926 CAGGTACACACCACCACGCCTGG - Intergenic
917940931 1:179920895-179920917 CAGGTTCACACCACCATGCCCGG + Intronic
918493723 1:185110799-185110821 CAGGTGCACATCGCCACGCCTGG + Intergenic
919151895 1:193711756-193711778 CAGGTGCACACCACCACGCCTGG + Intergenic
919546102 1:198921053-198921075 CAGGTGCACACCGCCATGCCCGG + Intergenic
919606574 1:199691342-199691364 CAGACTCACACCACCACGCCCGG + Intergenic
920083526 1:203396443-203396465 CAGGTGCGCACCGCCACGCCCGG + Intergenic
920492037 1:206423915-206423937 CAGGTGCACACCACCACGCCTGG + Intronic
920991404 1:210943489-210943511 CCGGCGCACACCGCCACGCCCGG + Intronic
921003066 1:211064416-211064438 CAGCTGCCCACCACCACGCCGGG - Intronic
922256855 1:223900059-223900081 CAGGTACACACCACCACGCCTGG + Intergenic
922422624 1:225469953-225469975 CAGGTGCACACCACCACGCCAGG - Intergenic
922434052 1:225585644-225585666 CAGGTGCACACCACCACGCCCGG - Intronic
922711228 1:227834524-227834546 CAGGTGCACACCACCACGCCCGG - Intronic
923682690 1:236131121-236131143 CAGGTGCACACCACCACGCCTGG + Intergenic
923720534 1:236463434-236463456 CAGGTGCACACCACCACGCCCGG + Intronic
923793396 1:237130567-237130589 CAGGTGCACACCACCACGCCTGG - Intronic
923967460 1:239157393-239157415 CAGGTACACACCACCACGCCTGG + Intergenic
924155118 1:241167659-241167681 CAGGTGCACACCACCACGCCCGG + Intronic
924232221 1:241971704-241971726 CAGGTGCACACCGCCACGTCTGG + Intergenic
924249255 1:242115033-242115055 CAGGTGCACACCACCACGCCTGG - Intronic
924338051 1:243002872-243002894 CAGGTACACACCACCACGCCTGG + Intergenic
924405878 1:243745193-243745215 CAGGTGCACACCACCACGCCGGG - Intronic
924521378 1:244809220-244809242 CAGGTGCACACCACCACGCCCGG + Intergenic
924585174 1:245355451-245355473 CAGCTGCACACCACCATGCCTGG - Intronic
924757889 1:246958199-246958221 CAGGTGCACACCACCACGCCCGG + Intronic
1062793663 10:326036-326058 CAGGTGCACACCACCACGCCTGG - Intronic
1062802369 10:389607-389629 GCTCTCCACACAGCCACGCCGGG - Intronic
1063050512 10:2442166-2442188 CAGGTACACACCACCACGCCCGG + Intergenic
1063452379 10:6159250-6159272 CAGGTGCCCACCGCCACGCCTGG - Intronic
1063677628 10:8155399-8155421 CAGGTGCACACCGCCATGCCTGG - Intergenic
1064049539 10:12048346-12048368 CAGATGCACACCGCCACGCCTGG + Intergenic
1064062811 10:12152914-12152936 CAGGCACACACCGCCACGCCTGG - Intronic
1064083003 10:12323605-12323627 CAGGTGCACACCACCACGCCTGG + Intergenic
1064191992 10:13214870-13214892 CAGGTGCACACCACCACGCCCGG + Intergenic
1064356023 10:14618692-14618714 CAGGTTCACACCACCATGCCTGG - Intronic
1064381459 10:14845472-14845494 CCGCCTCACACCTCCATCCCTGG - Intronic
1064544677 10:16438423-16438445 CAGGTGCACACCACCACGCCCGG + Intronic
1064650156 10:17500799-17500821 CAGGTGCACACCACCACGCCTGG + Intergenic
1064967883 10:21033595-21033617 CAGGTGCACACCGCCATGCCTGG - Intronic
1065087551 10:22194605-22194627 CAGGTGCACACCACCACGCCTGG - Intergenic
1065199264 10:23298110-23298132 CAGGTGCACACCACCACGCCTGG - Intronic
1065202345 10:23325192-23325214 AGGCTACACACCACCACGCCTGG - Intronic
1065340273 10:24697715-24697737 CAGCTGCACACCACCATGCCCGG - Intronic
1065581477 10:27175952-27175974 CAGATGCACACCACCACGCCTGG - Intronic
1065700717 10:28422949-28422971 CGGGTGCACACCACCACGCCTGG - Intergenic
1065700848 10:28424012-28424034 CAGGTGCACACCCCCACGCCTGG + Intergenic
1065761661 10:28988357-28988379 CAGCTGCCCACCACCACGCCCGG - Intergenic
1065897795 10:30179690-30179712 CAGGTGCACACCACCACGCCCGG + Intergenic
1065934116 10:30505251-30505273 CAGATGCACACCACCACGCCCGG - Intergenic
1066464746 10:35641804-35641826 CCACTTCTCCCCGCCGCGCCGGG + Exonic
1066558365 10:36640452-36640474 CAGGTGCACACCACCACGCCCGG - Intergenic
1067882062 10:50054343-50054365 CAGGCTCACACCGCCATGCCCGG + Intergenic
1068247379 10:54390433-54390455 CAGCTGCCCACCACCACGCCCGG + Intronic
1068815920 10:61312878-61312900 CAGGTGCACACCGCCATGCCCGG + Intergenic
1069328042 10:67255150-67255172 CAGGTGCACACCGCCATGCCTGG - Intronic
1069412753 10:68169880-68169902 CAGGTGCACACCACCACGCCTGG + Intronic
1069454462 10:68542864-68542886 CAGCCTCACACCACCACGCCTGG + Intergenic
1069896033 10:71680603-71680625 CAGGTGCACACCACCACGCCTGG - Intronic
1070005945 10:72424253-72424275 CAGGTGCACACCACCACGCCTGG + Intronic
1070033698 10:72701667-72701689 CAGGTACACACCACCACGCCCGG + Intronic
1070260062 10:74846004-74846026 CAGGTGCACACCACCACGCCCGG + Intronic
1070330354 10:75412146-75412168 CAGGTACACACCACCACGCCTGG + Intergenic
1070373746 10:75809498-75809520 CAGGTGCACACCACCACGCCTGG - Intronic
1070913673 10:80139092-80139114 CAGGTGCCCACCGCCACGCCCGG + Intronic
1070914870 10:80146800-80146822 CAGGTGCACACCACCACGCCTGG + Intergenic
1070974761 10:80597521-80597543 CAGGTGCACACCGCCATGCCTGG - Intronic
1071585034 10:86811936-86811958 CAGGTTGACACCACCACGCCTGG - Intronic
1072061883 10:91821178-91821200 CAGGTGCACACCACCACGCCTGG + Intronic
1072125939 10:92445390-92445412 CAGGTGCACACCGCCACACCTGG - Intergenic
1072239774 10:93484971-93484993 CAGGTGCACACCACCACGCCCGG + Intergenic
1072652811 10:97308913-97308935 CAGGTGCACACCACCACGCCTGG + Intergenic
1073079004 10:100845366-100845388 CAGCGACACACCACCACGCCTGG + Intergenic
1073213520 10:101823499-101823521 CAGGTGCACACCACCACGCCTGG - Intergenic
1073362420 10:102910422-102910444 CAGGTGCACACCGCCACGCCTGG + Intergenic
1073445832 10:103579797-103579819 CAGGTGCACACCACCACGCCTGG - Intronic
1073753595 10:106557664-106557686 CAGTTTCCCACCACCACGCCCGG + Intergenic
1074310417 10:112317650-112317672 CAGGCTCACACCACCACGCCTGG + Intergenic
1074595195 10:114857450-114857472 CAGGTGCACACCACCACGCCTGG + Intronic
1074811569 10:117110492-117110514 CAGGTGCACACCGCCATGCCTGG + Intronic
1075384018 10:122041587-122041609 CAGGTGCACACCGCCATGCCTGG + Intronic
1075506348 10:123025916-123025938 CAGGTGCACACCACCACGCCTGG - Intronic
1075600361 10:123763180-123763202 CAGGTGCACACCACCACGCCTGG + Intronic
1075888574 10:125924664-125924686 CAGGCTCACACCACCACGCCAGG - Intronic
1076013405 10:127008238-127008260 CAGGTGCACACCACCACGCCTGG + Intronic
1076466495 10:130686082-130686104 CAGGTGCACACCACCACGCCAGG - Intergenic
1077022446 11:424049-424071 CAGGCTCACACCACCACGCCTGG + Intronic
1077064453 11:634229-634251 CAGGTGCACACCACCACGCCCGG + Intergenic
1077112403 11:867701-867723 CTGCTTCACCCCCCCACCCCGGG + Intergenic
1077185518 11:1233887-1233909 CCGCATCACCCCGCCTGGCCTGG + Intronic
1077391145 11:2301168-2301190 CCTCTTCCCACAGCCACGCTGGG + Intronic
1077424558 11:2468287-2468309 CAGATGCACACCACCACGCCTGG + Intronic
1077512979 11:2981093-2981115 CAGGTTCACACCAGCACGCCTGG - Intronic
1077513299 11:2983844-2983866 CAGGTTCACACCACCATGCCTGG - Intronic
1077606607 11:3616740-3616762 CAGCTTCCCACCTCCACTCCTGG + Intergenic
1077617884 11:3691694-3691716 CAGCTGCACACCACCACACCCGG + Intronic
1077627007 11:3781041-3781063 CAGTTGCACACCACCACGCCTGG - Intronic
1077969293 11:7170860-7170882 CAGGTGCACACCACCACGCCTGG - Intergenic
1077971181 11:7192760-7192782 CAGGTGCACACCACCACGCCCGG + Intergenic
1078273428 11:9818862-9818884 CAGGTGCACACCACCACGCCCGG + Intronic
1078318905 11:10315960-10315982 CAGGTGCACACCACCACGCCTGG + Intronic
1078390206 11:10930851-10930873 ACGCTTCCCGCCGCCTCGCCCGG + Intergenic
1079065232 11:17285285-17285307 CCACCTCACCCAGCCACGCCCGG - Intronic
1079180619 11:18190168-18190190 CCGGTGCGCACCACCACGCCTGG - Intronic
1079207763 11:18431685-18431707 CAGGTGCACACCACCACGCCTGG + Intronic
1079215337 11:18505396-18505418 CAGGTTCACACCACCATGCCTGG + Intronic
1079474421 11:20814136-20814158 CAGGCGCACACCGCCACGCCCGG + Intronic
1079796884 11:24814847-24814869 CAGGCGCACACCGCCACGCCTGG - Intronic
1080323622 11:31044332-31044354 CAGGTTCTCACCACCACGCCCGG - Intronic
1080471100 11:32546418-32546440 CAGGTGCACACCACCACGCCTGG + Intergenic
1080473504 11:32568985-32569007 CAGGTGCACACCACCACGCCTGG + Intergenic
1080543913 11:33297234-33297256 CAGGTGCACACCACCACGCCTGG + Intronic
1080918250 11:36682201-36682223 CAGGTGCACACCACCACGCCCGG + Intergenic
1081075290 11:38666056-38666078 CAGGTGCACACCACCACGCCCGG + Intergenic
1081131355 11:39383988-39384010 CAGGTGCACACCACCACGCCTGG - Intergenic
1081490744 11:43566670-43566692 CAGGCGCACACCGCCACGCCCGG + Intronic
1081837884 11:46172667-46172689 CAGGTGCACACCACCACGCCCGG - Intergenic
1082839877 11:57680232-57680254 CAGATGCACACCACCACGCCCGG - Intronic
1082848239 11:57743293-57743315 CAGGTGCACACCACCACGCCTGG + Intronic
1083211762 11:61192296-61192318 CAGGTGCACACCACCACGCCCGG - Intergenic
1083321518 11:61850391-61850413 CAGGTGCACACCACCACGCCTGG + Intronic
1083353001 11:62044461-62044483 CAGGTGCACACCACCACGCCCGG + Intergenic
1083392423 11:62364014-62364036 CAGGTGCACACTGCCACGCCTGG - Intronic
1083435580 11:62640688-62640710 CAGCTGCCCACCACCACGCCTGG - Intronic
1083465884 11:62845779-62845801 CAGGTGCACACCACCACGCCTGG + Intergenic
1083469294 11:62872053-62872075 CAGGCACACACCGCCACGCCTGG + Intronic
1083583884 11:63842357-63842379 CAGGCACACACCGCCACGCCCGG + Intronic
1083586867 11:63866207-63866229 CAGATGCACACCACCACGCCTGG - Intronic
1083723438 11:64615177-64615199 CCACTTCACAACTCCATGCCGGG + Intronic
1083838682 11:65290103-65290125 CAGGTGCCCACCGCCACGCCTGG - Intronic
1083873464 11:65506916-65506938 CAGGTGCACACCACCACGCCTGG + Intergenic
1084115214 11:67039158-67039180 CAGGTGCACACCACCACGCCCGG - Intronic
1084133038 11:67152168-67152190 CAGGTGCACACCACCACGCCTGG - Intronic
1084357355 11:68648868-68648890 CAGGTGCACACCACCACGCCTGG + Intergenic
1084397480 11:68922536-68922558 CAGATGCACACCACCACGCCTGG + Intronic
1084662305 11:70553230-70553252 CAGCTGCCCACCACCACGCCAGG + Intronic
1084737159 11:71112970-71112992 CCGCTTCCCTCCACCACGCCAGG + Intronic
1085259637 11:75196971-75196993 CAGGTGCACACCACCACGCCTGG - Intronic
1085287521 11:75373575-75373597 CGGGTGCACACCACCACGCCTGG + Intergenic
1085428566 11:76426548-76426570 CAGGTGCACACCACCACGCCTGG - Intergenic
1086101156 11:83101310-83101332 CAGGTGCACACCACCACGCCCGG - Intergenic
1086141871 11:83508377-83508399 CAGGTGCACACCACCACGCCTGG + Intronic
1086667012 11:89495083-89495105 CAGGTGCACACCACCACGCCTGG + Intronic
1087183427 11:95161074-95161096 CAGGTGCACACCACCACGCCAGG - Intergenic
1087217483 11:95509432-95509454 CAGGTGCACACCGCCACACCCGG + Intergenic
1087535498 11:99439563-99439585 CAGGTGCACACCACCACGCCAGG - Intronic
1087749737 11:101994090-101994112 CAGGTGCACACCACCACGCCTGG - Intronic
1088023303 11:105146502-105146524 CAGGTGCACACTGCCACGCCGGG - Intergenic
1088248488 11:107841921-107841943 CAGGTGCACACCACCACGCCCGG - Intronic
1088272156 11:108044902-108044924 CAGGTGCACACCACCACGCCTGG + Intronic
1088531663 11:110817364-110817386 CAGGTGCACACCACCACGCCCGG + Intergenic
1088621264 11:111686296-111686318 CAGGTGCACACCACCACGCCTGG - Intronic
1088635620 11:111817593-111817615 CAGGTGCACACCACCACGCCTGG + Intronic
1088682938 11:112259893-112259915 CAGGTGCACACCACCACGCCTGG - Intronic
1089159943 11:116429580-116429602 CAGGTACACACCACCACGCCTGG - Intergenic
1089161927 11:116444977-116444999 CCGGTGCCCACCACCACGCCAGG + Intergenic
1089235290 11:117019160-117019182 CAGGTGCACACCGCCACACCTGG + Intronic
1089264088 11:117245174-117245196 CAGGTGCACACCACCACGCCCGG - Intronic
1089264335 11:117247706-117247728 CAGGTGCACGCCGCCACGCCTGG - Intronic
1089411318 11:118245253-118245275 CTGCCTCCCACCACCACGCCTGG - Intronic
1089840426 11:121412676-121412698 CAGGTGCACACCACCACGCCTGG - Intergenic
1090048313 11:123356031-123356053 CAGGTGCACACCACCACGCCTGG - Intergenic
1090099788 11:123782220-123782242 CAGGTGCACACCACCACGCCCGG - Intergenic
1090280842 11:125454869-125454891 CAGGTTCACACCACCACGCCTGG - Intronic
1090758501 11:129815770-129815792 CCGCTCCACTCCGCCAGGCCTGG - Intergenic
1090764285 11:129863448-129863470 CAGGTGCACACCACCACGCCCGG + Intergenic
1090826810 11:130393186-130393208 CAGGTACACACCACCACGCCTGG + Intergenic
1090829696 11:130412354-130412376 CAGGTGCACACCTCCACGCCTGG + Intronic
1091439961 12:505031-505053 CAGGTGCACACCACCACGCCTGG + Intronic
1091576567 12:1742233-1742255 CAGGTGCACACCACCACGCCTGG + Intronic
1092127064 12:6082107-6082129 CAGGTGCACACCACCACGCCCGG + Intronic
1092248554 12:6877966-6877988 CAGGTGCACACCACCACGCCTGG - Intronic
1092816699 12:12318565-12318587 CAGGTTCACGCCACCACGCCTGG - Intergenic
1092826787 12:12407850-12407872 CAGGTGCACACCACCACGCCTGG + Intronic
1093727386 12:22530598-22530620 CAGGTTCACACCACCACACCCGG + Intronic
1094096416 12:26710089-26710111 CAGGTTCACACCACCATGCCTGG - Intronic
1094256886 12:28440913-28440935 CAGGTGCACACCACCACGCCTGG - Intronic
1094436983 12:30431445-30431467 CGGGTGCACACCACCACGCCCGG - Intergenic
1094548620 12:31429016-31429038 CCACTGCACCCGGCCACGCCCGG + Intronic
1094608720 12:31972461-31972483 CCGGTGCCCACCACCACGCCTGG - Intronic
1094686668 12:32723549-32723571 CAGCTGCCCACCACCACGCCCGG - Intronic
1095263389 12:40124622-40124644 CAGGTGCACACCGCCACACCCGG - Intergenic
1095268010 12:40182439-40182461 CAGGTGCACACCGCCACACCTGG - Intergenic
1095700596 12:45187257-45187279 CAGGTGCACACCACCACGCCTGG - Intergenic
1096129461 12:49146147-49146169 CAGGTGCACACCACCACGCCTGG - Intergenic
1096367740 12:51042936-51042958 CAGGTGCACACCACCACGCCTGG + Intergenic
1096479735 12:51931127-51931149 CAGGTGCACACCACCACGCCTGG - Intergenic
1096690450 12:53317598-53317620 CAGGTGCACACCACCACGCCTGG - Intronic
1096834802 12:54342997-54343019 CAGGTGCACACCACCACGCCCGG + Intronic
1097006592 12:55923421-55923443 CAGGTACACACCACCACGCCTGG - Intronic
1097018896 12:56006465-56006487 CAGGCGCACACCGCCACGCCCGG + Intronic
1097076166 12:56396433-56396455 CAGGTGCACACCACCACGCCTGG - Intergenic
1097231453 12:57514298-57514320 CAGGTGCACACCACCACGCCCGG + Intronic
1097399799 12:59114822-59114844 CAGCTGCACACCACCATGCCTGG - Intergenic
1097597363 12:61650714-61650736 CAGGCACACACCGCCACGCCTGG - Intergenic
1097723222 12:63046270-63046292 CAGGTGCACACCACCACGCCTGG + Intergenic
1098047806 12:66419952-66419974 CAGGTGCACACCGCCATGCCCGG - Intronic
1098104339 12:67053693-67053715 CAGGTACACACCACCACGCCTGG - Intergenic
1098383152 12:69890589-69890611 CAGGTGCACACCACCACGCCCGG - Intronic
1098425948 12:70366179-70366201 CCGCTCCGCCCCGCCCCGCCCGG - Intergenic
1098874960 12:75857632-75857654 CAGGTGCACACCACCACGCCTGG + Intergenic
1099219699 12:79898311-79898333 CAGGTGCACACCGCCACACCTGG - Intronic
1099753830 12:86814051-86814073 CAGGTGCACACTGCCACGCCTGG + Intronic
1100475561 12:94932196-94932218 CAGGTGCACACCACCACGCCTGG - Intronic
1100532075 12:95470081-95470103 CAGGTGCACACCACCACGCCTGG + Intergenic
1100548216 12:95623327-95623349 CAGGTGCACACCACCACGCCTGG - Intergenic
1100553600 12:95671139-95671161 CAGGTGCACACCACCACGCCTGG + Intronic
1100626724 12:96342417-96342439 CAGGTGCACACCACCACGCCTGG - Intronic
1101083519 12:101212626-101212648 CAGGTGCACACCACCACGCCCGG + Intergenic
1101350384 12:103924985-103925007 CAGGTGCACACCACCACGCCTGG + Intergenic
1101854288 12:108429324-108429346 CCGATGCACACCACCACACCTGG + Intergenic
1101935093 12:109050862-109050884 CAGGTGCACACCACCACGCCCGG - Intronic
1102152393 12:110697792-110697814 CAGGTGCACACCACCACGCCTGG + Intronic
1102479166 12:113209072-113209094 CAGGTGCACACCACCACGCCTGG + Intronic
1102855739 12:116291768-116291790 CAGGTGCACACCACCACGCCTGG + Intergenic
1102871133 12:116414639-116414661 CAGGTGCACACCACCACGCCCGG - Intergenic
1102926696 12:116831986-116832008 CGGGTACACACCACCACGCCTGG - Intronic
1102966265 12:117130086-117130108 CAGGTACACACCACCACGCCTGG + Intergenic
1103066745 12:117905037-117905059 CAGGTGCACACCACCACGCCTGG - Intronic
1103196243 12:119045893-119045915 CAGGTGCACACCACCACGCCTGG - Intronic
1103386046 12:120533544-120533566 CAGGTGCGCACCGCCACGCCAGG + Intronic
1103411284 12:120713528-120713550 CAGCTTCAAACCACCATGCCTGG - Intronic
1103603982 12:122073203-122073225 CAGGTACACACCACCACGCCTGG + Intergenic
1103642187 12:122360442-122360464 CTGGTGCACACCACCACGCCTGG - Intronic
1103664262 12:122549508-122549530 CAGATGCACACCGCCACACCAGG + Intronic
1103711444 12:122915717-122915739 CAGGTGCACACCGCCACACCTGG + Intergenic
1103809513 12:123602267-123602289 CAGCCTCACTCCCCCACGCCAGG - Intronic
1104117723 12:125765629-125765651 CTGGTGCACACCACCACGCCGGG - Intergenic
1104913282 12:132250646-132250668 CAGGTGCACACCACCACGCCCGG - Intronic
1105267127 13:18830572-18830594 CAGGTGCACACCACCACGCCTGG + Intergenic
1105312660 13:19226890-19226912 CAGGTGCACACCGCCATGCCTGG + Intergenic
1105398912 13:20070651-20070673 CAGGTGCACACCACCACGCCCGG + Intronic
1105515058 13:21082026-21082048 CAGGTGCACACCACCACGCCCGG + Intergenic
1105759874 13:23503832-23503854 CAGGTGCACACCTCCACGCCTGG + Intergenic
1106155152 13:27147983-27148005 CAGGTGCACACCACCACGCCTGG - Intronic
1106173988 13:27312862-27312884 CAGGTGCACACTGCCACGCCTGG + Intergenic
1106417260 13:29556519-29556541 CAGGTGCACACCACCACGCCTGG + Intronic
1106538342 13:30667737-30667759 CCGCTACACCCGGCCACACCCGG + Intergenic
1106554849 13:30800623-30800645 CAGATTCACACCACCATGCCTGG + Intergenic
1107018409 13:35727710-35727732 CAGGTGCACACCACCACGCCAGG + Intergenic
1107303723 13:38995061-38995083 CAGATGCACGCCGCCACGCCCGG + Intergenic
1107514634 13:41117042-41117064 CAGGTGCACACCACCACGCCCGG - Intergenic
1107949806 13:45451763-45451785 CCGCCGCACACCACCATGCCTGG - Intergenic
1107954294 13:45495516-45495538 CAGATGCACACCACCACGCCTGG + Intronic
1108060520 13:46528648-46528670 CAGGTGCACACCACCACGCCTGG - Intergenic
1108229443 13:48320686-48320708 CAGGCTCACACCACCACGCCCGG - Intronic
1108283144 13:48879013-48879035 CAGGTGCACACCACCACGCCCGG - Intergenic
1108392475 13:49960118-49960140 CAGGTGCACACCACCACGCCTGG - Intergenic
1110081760 13:71322232-71322254 CAGGTGCACACCGCCATGCCTGG - Intergenic
1110186732 13:72683641-72683663 CAGGTGCACACCACCACGCCTGG + Intergenic
1110203430 13:72881571-72881593 CAGGTGCACACCACCACGCCTGG - Intronic
1110326121 13:74217582-74217604 CAGGTGCACACCACCACGCCCGG - Intergenic
1110419015 13:75284073-75284095 CAGATGCACACCACCACGCCTGG + Intergenic
1110421411 13:75313662-75313684 CAGGTGCACACCGCCACACCTGG + Intronic
1111229178 13:85318503-85318525 CAGGTGCACACCACCACGCCTGG - Intergenic
1111517906 13:89359088-89359110 CAGGTGCACACCACCACGCCTGG - Intergenic
1112053043 13:95663086-95663108 CAGGTGCACACCACCACGCCTGG - Intergenic
1112071432 13:95855142-95855164 CAGGTGCACACCACCACGCCTGG - Intronic
1112293504 13:98165858-98165880 CAGGTGCACACCACCACGCCTGG + Intronic
1112403143 13:99093655-99093677 CAGGCGCACACCGCCACGCCCGG - Intergenic
1112890069 13:104218857-104218879 CAGGTGCACACCACCACGCCTGG - Intergenic
1113390086 13:109887822-109887844 CAGGTGCACACCACCACGCCTGG - Intergenic
1114308605 14:21445544-21445566 CAGGTGCACACCACCACGCCTGG - Intronic
1114849618 14:26368198-26368220 CAGGTGCACACCGCCATGCCCGG - Intergenic
1114919914 14:27313056-27313078 CAGCTGCACACCACCATGCCTGG - Intergenic
1115039682 14:28908627-28908649 CCGGTGCCCACCACCACGCCCGG - Intergenic
1115322730 14:32101838-32101860 CAGGTACACACCACCACGCCTGG - Intronic
1115656668 14:35449841-35449863 CAGGTGCACACCACCACGCCTGG - Intergenic
1116747160 14:48834538-48834560 CAGGCACACACCGCCACGCCCGG + Intergenic
1116891004 14:50268234-50268256 CAGGTGCACACCACCACGCCAGG - Intronic
1117053690 14:51888459-51888481 CAGGTGCACACCACCACGCCTGG + Intronic
1117138141 14:52758716-52758738 CAGGTGCACACCACCACGCCTGG + Intronic
1117304551 14:54460655-54460677 CAGGTGCACACCACCACGCCTGG + Intergenic
1117947128 14:61040312-61040334 CAGCTGCATACCACCACGCCTGG + Intronic
1118164666 14:63324577-63324599 CGGGTGCACACCACCACGCCTGG + Intergenic
1118398849 14:65361211-65361233 CAGGTGCACACCACCACGCCCGG - Intergenic
1118894389 14:69933658-69933680 CAGGTGCACACCACCACGCCTGG + Intronic
1119024456 14:71141511-71141533 CAGGTGCACACCACCACGCCTGG + Intergenic
1119065793 14:71525114-71525136 CAGGCTCACACCACCACGCCTGG + Intronic
1119118781 14:72053260-72053282 CAGCTGCCCACCACCACGCCTGG + Intronic
1119312723 14:73663346-73663368 CAGGTGCCCACCGCCACGCCTGG + Intronic
1119337202 14:73843792-73843814 CAGGTACACACCACCACGCCTGG + Intergenic
1119358141 14:74024311-74024333 CAGGTGCACACTGCCACGCCTGG - Intronic
1119459488 14:74788261-74788283 CAGGTGCCCACCGCCACGCCTGG + Intronic
1119517745 14:75261579-75261601 CAGGTGCACACTGCCACGCCCGG + Intronic
1119674700 14:76545019-76545041 CAGGTGCACGCCGCCACGCCTGG - Intergenic
1119780031 14:77271200-77271222 CCGCCCCACCCCGCGACGCCTGG + Exonic
1120002917 14:79323714-79323736 CAGGCGCACACCGCCACGCCCGG - Intronic
1120180150 14:81334978-81335000 CAGCCACACACCACCACGCCTGG + Intronic
1120219112 14:81712780-81712802 CAGGTGCACACCACCACGCCTGG + Intergenic
1120583049 14:86278016-86278038 CAGGTGCACACCACCACGCCTGG - Intergenic
1120629660 14:86874610-86874632 CAGCCGCACACCACCACGCCCGG + Intergenic
1120757786 14:88260083-88260105 CAGGTGCACACCACCACGCCTGG + Intronic
1120887728 14:89464838-89464860 CAGCTGCCCACCACCACGCCCGG + Intronic
1120904591 14:89609343-89609365 CAGGTGCACACCACCACGCCCGG + Intronic
1121048414 14:90804415-90804437 CCTCTCCACACCACCAGGCCAGG - Intronic
1121350946 14:93172458-93172480 CAGGTGCACACCACCACGCCTGG + Intergenic
1121416398 14:93782123-93782145 CAGGTGCCCACCGCCACGCCCGG - Intronic
1122038133 14:98963025-98963047 CAGGTGCCCACCGCCACGCCCGG - Intergenic
1122150511 14:99723449-99723471 CAGGTGCACACCCCCACGCCTGG + Intronic
1122482081 14:102053879-102053901 CAGGTGCACACCACCACGCCCGG + Intergenic
1122489441 14:102103859-102103881 CAGGTGCACACCGCCACACCTGG - Intronic
1122571086 14:102701868-102701890 CAGGTGCACACCACCACGCCTGG + Intronic
1122708466 14:103637385-103637407 CAGGTGCACACCACCACGCCTGG - Intronic
1122728436 14:103776727-103776749 CAGGCGCACACCGCCACGCCCGG - Intronic
1123004471 14:105314723-105314745 CCGCTCCGCCCCGCCCCGCCCGG - Exonic
1123802806 15:23839038-23839060 CAGGTGCACACCACCACGCCCGG - Intergenic
1124107067 15:26748881-26748903 CAGGTGCACACCACCACGCCTGG - Intronic
1124184135 15:27507359-27507381 CAGGCTCACACCACCACGCCTGG - Intronic
1124469450 15:29969677-29969699 CAGGTGCACACCACCACGCCTGG - Intergenic
1124913446 15:33945726-33945748 CAGGTGCACACCACCACGCCTGG + Intronic
1124921699 15:34033361-34033383 CAGGTGCACACCGCCACACCCGG - Intronic
1125082313 15:35689424-35689446 CAGCAACACACCACCACGCCTGG + Intergenic
1125306273 15:38319520-38319542 CAGGTTCCCACCACCACGCCCGG + Intronic
1125557965 15:40601982-40602004 CAGGTGCACGCCGCCACGCCTGG + Intronic
1125821037 15:42631435-42631457 CCGGCGCACACCACCACGCCTGG - Intronic
1126115404 15:45203025-45203047 CAGGTACACACCGCCACACCTGG - Intergenic
1126159556 15:45597334-45597356 CAGGTGCACACCACCACGCCAGG - Intronic
1126187865 15:45848057-45848079 CAGGTGCACACCACCACGCCTGG - Intergenic
1126405790 15:48321315-48321337 CAGGTGCACGCCGCCACGCCCGG + Intergenic
1126761892 15:51977143-51977165 CAGGTGCACACCACCACGCCCGG + Intronic
1126820421 15:52497612-52497634 CAGGTGCACACTGCCACGCCCGG - Intronic
1126840739 15:52715251-52715273 CCCCTTCAAACAGCCACCCCAGG + Intergenic
1127128236 15:55834647-55834669 CAGGTTCACACCACCATGCCTGG - Intronic
1127144439 15:56010072-56010094 CAGGTACACACCACCACGCCTGG - Intergenic
1127213473 15:56799699-56799721 CAGGTTCACACCACCATGCCTGG - Intronic
1127432383 15:58923214-58923236 CAGGTGCACACCACCACGCCTGG - Intronic
1127517720 15:59712713-59712735 CCGGCACACACCACCACGCCTGG + Intergenic
1127895867 15:63298351-63298373 CAGCTGCACACTGCCACGCCTGG + Intronic
1127949947 15:63794921-63794943 CAGGTACACACCACCACGCCTGG - Intronic
1128128875 15:65212282-65212304 GGGCTTCACACCCCCACTCCCGG + Intergenic
1128167436 15:65478400-65478422 CAGGTGCACACCACCACGCCCGG + Intronic
1128290347 15:66473818-66473840 CCGGTGCACACCACCATGCCTGG + Intronic
1128429369 15:67576057-67576079 CAGGTGCACACCACCACGCCTGG + Intronic
1128463122 15:67886517-67886539 CAGGTGCACACCACCACGCCTGG + Intergenic
1128580660 15:68807477-68807499 CCGCTTCACAGCTCCAGGCGAGG + Intronic
1128628044 15:69231933-69231955 CAGGTACACACCACCACGCCTGG + Intronic
1128750697 15:70147081-70147103 CAGGTGCACACCGCCACACCTGG + Intergenic
1128916802 15:71570547-71570569 CAGGTGCACACCACCACGCCTGG + Intronic
1129099160 15:73242523-73242545 CAGGTGCACACCACCACGCCCGG - Intronic
1129128364 15:73465992-73466014 CAGGTGCACACCACCACGCCTGG + Intronic
1129129616 15:73481799-73481821 CAGCTGCACACCACCACGCCAGG + Intronic
1129266236 15:74394871-74394893 CTGGTGCACACCACCACGCCTGG + Intergenic
1129281596 15:74489416-74489438 CAGATGCACACCACCACGCCTGG + Intergenic
1129363862 15:75042508-75042530 CAGGTGCACACCACCACGCCTGG - Intronic
1129417433 15:75393948-75393970 CAGGTGCACACCACCACGCCTGG + Intronic
1129816053 15:78555500-78555522 CAGATGCACACCACCACGCCTGG + Intergenic
1129829037 15:78655356-78655378 CAGCTGCACACCACCACACCTGG + Intronic
1129859005 15:78845703-78845725 CAGGTGCACACCACCACGCCTGG + Intronic
1129998072 15:80023969-80023991 CAGGTGCACACCACCACGCCTGG + Intergenic
1130044500 15:80433426-80433448 CAGGTGCACACCACCACGCCCGG + Intronic
1130525858 15:84705710-84705732 CAGATGCACACCACCACGCCTGG - Intronic
1131262808 15:90897005-90897027 CAGGTGCACACCACCACGCCTGG - Intergenic
1131610314 15:93954076-93954098 CCACTTCAAACCAACACGCCAGG - Intergenic
1132141503 15:99400654-99400676 CAGGTGCACACCACCACGCCTGG + Intergenic
1132288916 15:100685785-100685807 CAGGTGCACACCACCACGCCCGG - Intergenic
1132341925 15:101084407-101084429 CAGGTACACACCACCACGCCTGG + Intergenic
1132411985 15:101587167-101587189 CAGGTGCACACCACCACGCCTGG - Intergenic
1132509248 16:329133-329155 CAGGTGCACACCACCACGCCTGG - Intronic
1133024094 16:2980218-2980240 CCGCTCCCCTCCGCCTCGCCAGG - Intronic
1133032180 16:3016621-3016643 CAGGTGCACACCACCACGCCCGG + Intronic
1133169901 16:3976132-3976154 CAGGTGCACACCGCCATGCCTGG + Intronic
1133195699 16:4168739-4168761 CAGTTGCACACCACCACGCCTGG + Intergenic
1133215400 16:4289072-4289094 CAGCTGCCCACCACCACGCCCGG - Intergenic
1133341478 16:5039290-5039312 CAGGTGCACACCGCCACGCCTGG - Intronic
1133763665 16:8820494-8820516 CCGGTGCCCACCACCACGCCTGG + Intronic
1134106663 16:11490251-11490273 CAGCTGCACACCACCATGCCCGG - Intronic
1134520323 16:14916338-14916360 CAGCTCCACACCACCATGCCTGG + Intronic
1134551252 16:15139636-15139658 CAGCTCCACACCACCATGCCTGG - Intergenic
1134553318 16:15148523-15148545 CAGATGCACACCACCACGCCCGG + Intergenic
1134707997 16:16314989-16315011 CAGCTCCACACCACCATGCCTGG + Intergenic
1134715210 16:16355022-16355044 CAGCTCCACACCACCATGCCTGG + Intergenic
1134951605 16:18353656-18353678 CAGCTCCACACCACCATGCCTGG - Intergenic
1134959547 16:18397137-18397159 CAGCTCCACACCACCATGCCTGG - Intergenic
1135588004 16:23685563-23685585 CAGGTGCACACCACCACGCCCGG - Intronic
1135590196 16:23699564-23699586 CAGGTGCACACCACCACGCCCGG + Intronic
1136082496 16:27861232-27861254 CAGGTGCACACCACCACGCCTGG - Intronic
1136137803 16:28268002-28268024 CAGGTGCACACCACCACGCCTGG - Intergenic
1136261823 16:29082399-29082421 CCCCTTCCCAGCGCCGCGCCCGG + Intergenic
1136345327 16:29671771-29671793 CAGGTGCACACCACCACGCCCGG - Intronic
1136421340 16:30135509-30135531 CAGGTGCACACCACCACGCCTGG + Intergenic
1136549539 16:30975571-30975593 CAGGTGCACACTGCCACGCCTGG + Intronic
1136784918 16:32928515-32928537 CAGGTGCACACCACCACGCCCGG - Intergenic
1137320774 16:47379543-47379565 CAGATGCACACCACCACGCCTGG - Intronic
1137643025 16:50049788-50049810 CAGGTACACACCACCACGCCTGG + Intergenic
1137650732 16:50117940-50117962 CAGGTGCACACCACCACGCCTGG - Intergenic
1137659620 16:50193478-50193500 CAGGTGCCCACCGCCACGCCCGG + Intronic
1138574155 16:57896568-57896590 CAGGTGCACACCACCACGCCCGG - Intronic
1138904871 16:61319113-61319135 CAGGTGCACACCGCCACACCTGG + Intergenic
1139108944 16:63864795-63864817 CAGGTGCACACCACCACGCCTGG - Intergenic
1139463872 16:67143393-67143415 CAGGTGCACACCACCACGCCCGG - Intronic
1139480796 16:67229631-67229653 CACCTTCACACCTCCAGGCCAGG + Exonic
1139600611 16:67984407-67984429 CCGGTGCGCACCACCACGCCTGG - Intergenic
1139628109 16:68208176-68208198 CAGGCTCACACCACCACGCCTGG + Intronic
1139705220 16:68736809-68736831 CAGGTGCACACCACCACGCCAGG - Intergenic
1139722164 16:68865132-68865154 CAGGCTCACACCACCACGCCCGG - Intronic
1139893247 16:70268023-70268045 CAGGTGCACACCGCCAAGCCTGG - Intronic
1139899461 16:70316350-70316372 CAGGTGCACACCACCACGCCTGG + Intronic
1140110039 16:71996401-71996423 CAGGTGCACACCACCACGCCTGG + Intronic
1140388976 16:74568558-74568580 CAGTTGCACACCACCACGCCTGG + Intronic
1140796457 16:78442978-78443000 CCGCGCCCCACCACCACGCCTGG - Intronic
1141944541 16:87300339-87300361 CAGGCTCACACCACCACGCCTGG - Intronic
1142068347 16:88075358-88075380 CCAGTGCACACCACCACGCCCGG - Intronic
1142339737 16:89513589-89513611 CAGGTGCACACCACCACGCCTGG - Intronic
1142438774 16:90080150-90080172 CAGGCACACACCGCCACGCCTGG - Intronic
1142548724 17:724197-724219 CAGGTGCACACCACCACGCCCGG + Intergenic
1142627011 17:1198596-1198618 CAGGTGTACACCGCCACGCCTGG - Intronic
1142661555 17:1433486-1433508 CAGGTGCACACCACCACGCCTGG + Intronic
1142730223 17:1849433-1849455 CAGGTGCCCACCGCCACGCCCGG + Intronic
1142781676 17:2186083-2186105 CAGGTGCACACCACCACGCCTGG - Intronic
1142843218 17:2650367-2650389 CAGGTGCACACCGCCACGTCTGG - Intronic
1142973889 17:3631663-3631685 CAGGCTCACACCACCACGCCGGG + Intronic
1143131424 17:4680418-4680440 CAGGCACACACCGCCACGCCTGG + Intronic
1143170788 17:4929023-4929045 CAGGTGCACACCACCACGCCGGG - Intergenic
1143232504 17:5368963-5368985 CAGGTGCACACCACCACGCCCGG - Intronic
1143262524 17:5610419-5610441 CAGGTGCACACCACCACGCCTGG + Intronic
1143398679 17:6625522-6625544 CAGGTGCACACCACCACGCCTGG - Intronic
1143669369 17:8385775-8385797 CAGGTGCACACCGCCACGCCCGG - Intergenic
1143769839 17:9161633-9161655 CAGGTGCACACCACCACGCCAGG - Intronic
1143894040 17:10122972-10122994 CAGGTGCACACCACCACGCCTGG + Intronic
1144025253 17:11271578-11271600 CAGGTGCACACCACCACGCCTGG + Intronic
1144101176 17:11943532-11943554 CAGGTGCACACCGCCACGCCTGG - Intronic
1144235955 17:13260685-13260707 CAGGTGCACACCACCACGCCCGG - Intergenic
1144312712 17:14027712-14027734 CTGCCTCACACAGCCTCGCCAGG - Intergenic
1144332045 17:14233615-14233637 CTGCCTCACACAGCCTCGCCAGG + Intergenic
1144483297 17:15644956-15644978 CAGATACACACCGCCACACCCGG + Intronic
1144498780 17:15767968-15767990 CTGCCTCACACAGCCTCGCCAGG - Intergenic
1144615716 17:16769968-16769990 CAGGTGCACACCACCACGCCTGG + Intronic
1144866001 17:18336132-18336154 CAGGTGCACACCACCACGCCCGG - Intronic
1144896989 17:18545699-18545721 CAGGTGCACACCACCACGCCTGG - Intergenic
1144915389 17:18720070-18720092 CAGATACACACCGCCACACCCGG - Intronic
1145094682 17:20015725-20015747 CCGGTGCCCACCACCACGCCCGG + Intronic
1145135228 17:20398507-20398529 CAGGTGCACACCACCACGCCTGG + Intergenic
1145162162 17:20583002-20583024 CTGCCTCACACAGCCTCGCCAGG - Intergenic
1145721019 17:27072856-27072878 CAGTTGCACACCACCACGCCTGG - Intergenic
1145869257 17:28259990-28260012 CAGGTGCACACCACCACGCCCGG - Intergenic
1145919141 17:28597273-28597295 CAGGTGCACACCACCACGCCTGG - Intronic
1145950698 17:28814607-28814629 CAGGTGCACACCACCACGCCTGG + Intronic
1146024170 17:29305350-29305372 CAGGCTCACACCACCACGCCTGG - Intergenic
1146047828 17:29525253-29525275 CAGGTGCACACCACCACGCCCGG + Intronic
1146134464 17:30306423-30306445 CAGGTACACACCACCACGCCTGG + Intergenic
1146138320 17:30342748-30342770 CAGGTGCACACCACCACGCCCGG + Intergenic
1146230935 17:31108414-31108436 CAGGTGCACACCACCACGCCTGG + Intronic
1146315450 17:31803215-31803237 CCACCGCACCCCGCCACGCCTGG - Intergenic
1146711784 17:35048257-35048279 CAGGTGCACACCGCCACTCCCGG - Intronic
1146998148 17:37338795-37338817 CAGGTGCCCACCGCCACGCCTGG - Intronic
1147616035 17:41828477-41828499 CAGCCACACACCACCACGCCCGG + Intronic
1148013781 17:44506420-44506442 CAGGTGCACACCACCACGCCCGG - Intergenic
1148051962 17:44773946-44773968 CAGGTGCACACCACCACGCCTGG - Intronic
1148054400 17:44785481-44785503 CAGGTGCGCACCGCCACGCCTGG - Intergenic
1148117799 17:45187530-45187552 CAGGTTCCCACCACCACGCCTGG - Intergenic
1148158815 17:45438387-45438409 CAGGCACACACCGCCACGCCCGG - Intronic
1148440247 17:47708501-47708523 CCCCATCTCACCGCCACTCCGGG - Exonic
1148844470 17:50521128-50521150 ACGCTTCATACCGCTACACCTGG + Exonic
1148883792 17:50756465-50756487 CAGCTTCGCACCACCACACCTGG + Intergenic
1148936887 17:51170282-51170304 CAGGTGCACACTGCCACGCCCGG + Intronic
1149190727 17:54058192-54058214 CCGGTGCACACCACCACGCCCGG + Intergenic
1149361058 17:55896375-55896397 CAGGTACACACCACCACGCCTGG + Intergenic
1149528678 17:57377930-57377952 CAGGTGCACACCACCACGCCTGG - Intronic
1149746575 17:59104947-59104969 CAGGTGCACACCACCACGCCTGG - Intronic
1149767258 17:59289612-59289634 CCGGTACACACCACCACACCCGG - Intergenic
1149796207 17:59522318-59522340 CAGGTGCACACCACCACGCCCGG - Intergenic
1149807634 17:59634049-59634071 CAGGTGCACACCACCACGCCTGG + Intronic
1149883344 17:60315255-60315277 CAGGCGCACACCGCCACGCCTGG - Intronic
1149966813 17:61172843-61172865 CAGGTGCCCACCGCCACGCCCGG - Intronic
1150355586 17:64481730-64481752 CAGGTACACACCGCCACACCTGG - Intronic
1150365953 17:64584499-64584521 CAGGTGCACACCACCACGCCTGG + Intronic
1150383320 17:64738029-64738051 CAGGTGCACACCACCACGCCTGG + Intergenic
1150481153 17:65512252-65512274 CAGGTTCACGCCACCACGCCCGG - Intergenic
1150694356 17:67391621-67391643 CAGGTACCCACCGCCACGCCCGG + Intronic
1150765958 17:68002400-68002422 CAGGTTCACGCCACCACGCCTGG + Intergenic
1150772923 17:68056738-68056760 CAGGTGCACACCACCACGCCTGG - Intergenic
1150775480 17:68078494-68078516 CAGGTGCACACCACCACGCCTGG + Intergenic
1150928834 17:69562928-69562950 CAGGTGCACACCACCACGCCCGG + Intergenic
1151158170 17:72142044-72142066 CAGGTGCACACCACCACGCCTGG + Intergenic
1151587405 17:75018372-75018394 CAGGTTCCCACCACCACGCCCGG + Intronic
1151636046 17:75348816-75348838 CAGGTGCACGCCGCCACGCCTGG + Intronic
1151690695 17:75683184-75683206 CAGGTGCACACCACCACGCCTGG + Intronic
1151787827 17:76284023-76284045 CAGGTGCACACCGCCATGCCTGG - Intronic
1151795359 17:76341378-76341400 CAGGTGCACACCACCACGCCTGG + Intronic
1151856252 17:76724262-76724284 CCGACGCACACCACCACGCCTGG + Intronic
1151904927 17:77041443-77041465 CAGGTGCACACCACCACGCCTGG - Intergenic
1151936091 17:77262300-77262322 CAGGTGCACACCACCACGCCTGG - Intergenic
1151949540 17:77342829-77342851 CAGGCACACACCGCCACGCCAGG - Intronic
1152094541 17:78265585-78265607 CAGCCACACACCACCACGCCTGG + Intergenic
1152113036 17:78367667-78367689 CAGGTGCACACCACCACGCCTGG + Intergenic
1152402834 17:80079074-80079096 CAGCCACACACCACCACGCCCGG + Intronic
1152489885 17:80623676-80623698 CAGGTGCACACCACCACGCCTGG + Intronic
1152531627 17:80922478-80922500 CCGGCTCACACGGCCACGCCAGG + Intronic
1152760487 17:82104832-82104854 CAGCTTCAAACCTCCAAGCCGGG - Intronic
1152835973 17:82531981-82532003 CAGGCTCACGCCGCCACGCCCGG + Intronic
1153020763 18:626716-626738 CAGTTGCACACCGCCATGCCTGG - Intronic
1153178854 18:2409854-2409876 CAGGTGCACACCGCCACACCTGG + Intergenic
1153255707 18:3168429-3168451 CAGGTGCACACCACCACGCCTGG + Intronic
1153451873 18:5238589-5238611 CCGCTTCACTCCTACAAGCCCGG + Intergenic
1153557324 18:6329294-6329316 CAGGTTCTCACCACCACGCCCGG + Intronic
1153620887 18:6976747-6976769 CAGGTTCACACCACCAAGCCTGG + Intronic
1153626671 18:7027798-7027820 CAGGTGCACACCACCACGCCCGG - Intronic
1154198355 18:12282194-12282216 CAGCTGCACACCACCATGCCTGG + Intergenic
1154421286 18:14230854-14230876 CAGGTGCACACCACCACGCCTGG - Intergenic
1155641709 18:28025373-28025395 CAGGTGTACACCGCCACGCCTGG - Intronic
1155654060 18:28175932-28175954 CCACTTCACACAGCCTCGGCCGG - Intronic
1155783199 18:29865562-29865584 CAGGTGCCCACCGCCACGCCCGG - Intergenic
1155792877 18:29996548-29996570 CAGGTGCACACTGCCACGCCCGG + Intergenic
1157186312 18:45543089-45543111 CAGGTGCACACCACCACGCCCGG + Intronic
1157262407 18:46187482-46187504 CAGGTGCACGCCGCCACGCCTGG + Intronic
1157528994 18:48406303-48406325 CCCCTTCACACCGCCCCTGCTGG + Intronic
1157885482 18:51362229-51362251 CAGGTGCACACCACCACGCCTGG - Intergenic
1158133445 18:54179045-54179067 CAGGTGCACACCACCACGCCTGG - Intronic
1158136982 18:54218817-54218839 CAGGTGCACACCACCACGCCTGG - Intronic
1158206001 18:54993490-54993512 CAGGCGCACACCGCCACGCCTGG - Intergenic
1158353050 18:56583721-56583743 CAGGTGCACACCACCACGCCTGG - Intergenic
1158468107 18:57709820-57709842 CAGGTGCACACCACCACGCCCGG + Intronic
1158589454 18:58767712-58767734 CAGCTGCACACTACCACGCCTGG - Intergenic
1158967699 18:62637030-62637052 CAGGTGCACACCACCACGCCAGG + Intergenic
1159042008 18:63333220-63333242 CAGGTACACACCACCACGCCTGG + Intronic
1159669942 18:71210928-71210950 CAGGTGCACACCACCACGCCTGG + Intergenic
1160007511 18:75078652-75078674 CAGGTGCACGCCGCCACGCCTGG - Intergenic
1160044035 18:75370521-75370543 CGGATGCACACCACCACGCCTGG + Intergenic
1160446301 18:78929652-78929674 CAGGTGCACACCACCACGCCTGG - Intergenic
1160476052 18:79189202-79189224 CAGGTGCACACCACCACGCCCGG - Intronic
1160683091 19:421255-421277 CAGGTTCCCACCACCACGCCCGG - Intronic
1160883084 19:1331353-1331375 CAGCTGCCCACCACCACGCCCGG - Intergenic
1160934488 19:1587106-1587128 CAGCTGCCCACCACCACGCCCGG + Intronic
1160960721 19:1719459-1719481 CAGGTGCACACCACCACGCCAGG - Intergenic
1160993232 19:1869747-1869769 CAGGTGCACACCGCCACGCCCGG + Intergenic
1161271884 19:3394335-3394357 CAGGTTCACGCCACCACGCCTGG - Intronic
1161339208 19:3731488-3731510 CAGGTGCACACCACCACGCCTGG - Intronic
1161353305 19:3805490-3805512 CAGGTGCACACCACCACGCCAGG + Exonic
1161360387 19:3845650-3845672 CAGGTGCACACCACCACGCCTGG - Intronic
1161387617 19:4004749-4004771 CAGGTGCACACCACCACGCCTGG - Intergenic
1161444901 19:4312660-4312682 CAGGTGCACACCGCCACGCCCGG - Intronic
1161607666 19:5223703-5223725 CAGGTACACACCACCACGCCTGG + Intronic
1161659821 19:5539359-5539381 CCGCTTCCCACCACCCTGCCTGG + Intergenic
1161747673 19:6070848-6070870 CAGGTGCACACCACCACGCCTGG + Intronic
1161762049 19:6181079-6181101 CAGGTGCACACCACCACGCCTGG - Intronic
1161786809 19:6331649-6331671 CAGGTTCCCACCACCACGCCTGG - Intronic
1161947015 19:7443759-7443781 CAGGTGCACACCACCACGCCTGG - Intronic
1161990171 19:7680345-7680367 CAGGTTCACACCACCACACCTGG + Intronic
1162112608 19:8408321-8408343 CAGGTTCACACCACCATGCCAGG + Intronic
1162305871 19:9873294-9873316 CAGGTGCACACCACCACGCCAGG + Intronic
1162357079 19:10192902-10192924 CAGGTGCACACCACCACGCCTGG - Intronic
1162415542 19:10534433-10534455 CAGGTGCACACTGCCACGCCTGG - Intergenic
1162468509 19:10857736-10857758 CAGGTGCACACCACCACGCCCGG - Intronic
1162537201 19:11270068-11270090 CAGGTGCACACCACCACGCCTGG + Intergenic
1162548404 19:11344996-11345018 CAGGTGCACACCACCACGCCTGG + Intronic
1162611520 19:11758575-11758597 CAGGTTCACACCACCACGCCTGG + Intergenic
1162974756 19:14202393-14202415 CAGGTGCACACCACCACGCCTGG + Intronic
1163012863 19:14436079-14436101 CAGGTGCACACCACCACGCCTGG + Intronic
1163064457 19:14783033-14783055 CAGGTGCACACCACCACGCCAGG + Intergenic
1163269238 19:16240590-16240612 CAGGTGCACACCACCACGCCCGG + Intronic
1163394574 19:17051995-17052017 CAGGTGCACACCACCACGCCCGG - Intronic
1163406665 19:17127152-17127174 CAGGTGCACACCACCACGCCCGG + Intronic
1163597153 19:18226746-18226768 CAGATGCACACCACCACGCCCGG + Intronic
1163628978 19:18407178-18407200 CAGATGCACACCACCACGCCTGG + Intergenic
1163881538 19:19927251-19927273 CAGCTGCACACCACCATGCCTGG - Intronic
1163901911 19:20109733-20109755 CAGCTGCACACCACCATGCCTGG - Intronic
1163971355 19:20798453-20798475 CAGCTGCACACCACCATGCCTGG - Intronic
1165159766 19:33809132-33809154 CAGGTGCACACCACCACGCCCGG - Intronic
1165340423 19:35207548-35207570 CAGGCACACACCGCCACGCCTGG - Intergenic
1165344452 19:35235665-35235687 CAGGTGCACACCGCCACGCCCGG - Intergenic
1165401435 19:35603169-35603191 CAGGTGCACACCACCACGCCTGG - Intergenic
1165545479 19:36531931-36531953 CAGGTGCACACCACCACGCCTGG + Intergenic
1165549134 19:36568612-36568634 CAGGTGCACACCACCACGCCTGG + Intronic
1165591191 19:36971679-36971701 CAGGTGCACACCACCACGCCAGG + Intronic
1165669732 19:37665340-37665362 CAGGTGCACGCCGCCACGCCCGG - Intronic
1165672931 19:37694821-37694843 CAGGTGCACACCACCACGCCTGG - Intronic
1165685701 19:37817763-37817785 CCACGTCACACAGGCACGCCCGG - Intergenic
1166016900 19:39988278-39988300 CAGGTGCACACCACCACGCCTGG + Intronic
1166134370 19:40766674-40766696 CCGGAGCACACCACCACGCCTGG - Intergenic
1166517354 19:43457305-43457327 CAGGTGCACACCACCACGCCCGG - Intergenic
1166607543 19:44158384-44158406 CAGGTGCACACCACCACGCCTGG + Exonic
1166860478 19:45807651-45807673 CAGGTGCACACCACCACGCCAGG + Intronic
1166961535 19:46499469-46499491 CTGCAGCACACCACCACGCCTGG + Intronic
1167042286 19:47029222-47029244 CAGGTGCACACCACCACGCCCGG + Intronic
1167057532 19:47121446-47121468 CAGGTGCCCACCGCCACGCCTGG + Intronic
1167075647 19:47247200-47247222 CAGGTGCACACCACCACGCCTGG + Intergenic
1167258467 19:48444248-48444270 CCGCGTCCCACCTCCACGCCCGG + Exonic
1167310403 19:48734454-48734476 CAGGTGCACACCACCACGCCCGG + Intronic
1167927879 19:52836423-52836445 CAGATGCACACCACCACGCCTGG - Intronic
1167932275 19:52875636-52875658 CAGATGCACACCACCACGCCTGG - Intronic
1167947873 19:53003676-53003698 CAGGCTCACACCACCACGCCTGG - Intergenic
1168069012 19:53938803-53938825 CAGGTGCACACCACCACGCCCGG - Intronic
1168070332 19:53946735-53946757 CAGGCACACACCGCCACGCCTGG + Intergenic
1168086127 19:54048256-54048278 CAGGTGCACACCACCACGCCTGG + Intronic
1168211526 19:54894215-54894237 CAGGTGCGCACCGCCACGCCCGG + Intergenic
1168230090 19:55025561-55025583 CAGGTGCACACCACCACGCCTGG - Intronic
1168523502 19:57070865-57070887 CAGGTGCACACCACCACGCCTGG - Intergenic
1168543079 19:57229118-57229140 CAGGTGCACACCACCACGCCCGG - Intergenic
925250121 2:2425876-2425898 CAGGCTCTCACCGCCACGCCTGG + Intergenic
926100861 2:10116679-10116701 CAGGTGCACACCACCACGCCCGG - Intergenic
926712555 2:15893050-15893072 CAGATGCACACCACCACGCCTGG - Intergenic
927175320 2:20401975-20401997 CAGGTGCACACCACCACGCCTGG + Intergenic
927327084 2:21817605-21817627 CAGGTGCACACCACCACGCCTGG + Intergenic
927626560 2:24726993-24727015 CAGCTGCGCACCACCACGCCTGG - Intronic
927858777 2:26544896-26544918 CAGGTTCGCACCACCACGCCTGG - Intronic
928068166 2:28187809-28187831 CAGGGTCACACCACCACGCCCGG + Intronic
928165650 2:28969953-28969975 CAGGTGCACACCACCACGCCCGG + Intronic
928301898 2:30132485-30132507 CAGGTACACACCACCACGCCTGG + Intergenic
928315830 2:30244761-30244783 CGGGTGCACACCACCACGCCTGG - Intronic
928569341 2:32587579-32587601 CAGGTGCACACCACCACGCCTGG - Intronic
928694809 2:33838627-33838649 CAGGTACACACCACCACGCCTGG - Intergenic
928965488 2:36971005-36971027 CAGGTGCACACCACCACGCCCGG + Intronic
928989553 2:37218122-37218144 CAGGCGCACACCGCCACGCCTGG - Intronic
929118276 2:38463273-38463295 CAGGTGCACACCCCCACGCCTGG + Intergenic
929472990 2:42215200-42215222 CCGATGCACACCACCACGCCTGG + Intronic
929537898 2:42795458-42795480 CAGGCTCACACCACCACGCCTGG + Intergenic
929548122 2:42869911-42869933 CAGGTGCACACCGCCAGGCCTGG - Intergenic
929677969 2:43956745-43956767 CCGGTGCCCACCACCACGCCTGG - Intronic
929708550 2:44241587-44241609 CAGGTGCACACCACCACGCCTGG - Intronic
929711993 2:44275201-44275223 CAGGTGCACACCACCACGCCTGG + Intergenic
929720937 2:44366862-44366884 CAGGTGCACACCACCACGCCTGG + Intronic
930117639 2:47732252-47732274 CCGCCACACGCCACCACGCCTGG + Intronic
930704362 2:54489555-54489577 CAGATGCACACCACCACGCCTGG - Intronic
930771141 2:55131739-55131761 CAGGTGCACACCACCACGCCCGG - Intergenic
931297972 2:60948366-60948388 TCATTTCACACCGCCATGCCCGG + Intronic
931342826 2:61418220-61418242 CTGGTACACACCACCACGCCTGG + Intronic
931357912 2:61553263-61553285 CAGGTGCACACCACCACGCCTGG - Intergenic
931358188 2:61555314-61555336 CAGCTGCACACCACCACACCTGG - Intergenic
931359865 2:61569256-61569278 CAGGTGCACACCACCACGCCTGG + Intergenic
931366921 2:61627309-61627331 CAGGTGCACACCACCACGCCAGG + Intergenic
932116120 2:69049451-69049473 CAGGTGCACACCGCCATGCCAGG + Intronic
932174979 2:69591711-69591733 CAGGTGCCCACCGCCACGCCTGG + Intronic
932186348 2:69699498-69699520 CGGGTTCACACCACCACGCCTGG - Intronic
932200616 2:69824358-69824380 CAGGTACACACCACCACGCCTGG - Intronic
932223595 2:70021459-70021481 CAGGTGCACACTGCCACGCCCGG + Intergenic
932656300 2:73613695-73613717 CAGGTGCACACCACCACGCCTGG - Intergenic
932810944 2:74825781-74825803 CAGATGCACACCGCCATGCCTGG + Intergenic
933105022 2:78313690-78313712 CTGGTGCACACCACCACGCCTGG - Intergenic
933673135 2:85028323-85028345 CAGGTGCACACCACCACGCCTGG + Intronic
933770304 2:85739770-85739792 CAGGTGCACACCACCACGCCTGG - Intergenic
933936354 2:87206976-87206998 CAGGTGCACACCACCACGCCTGG - Intergenic
934029529 2:88029988-88030010 CAGGTGCACACCACCACGCCTGG + Intronic
934496861 2:94810288-94810310 CAGGTGCACACCACCACGCCTGG + Intergenic
935521405 2:104109564-104109586 CAGGTGCACACCACCACGCCTGG - Intergenic
935667220 2:105523203-105523225 CAGGTGCACACCACCACGCCTGG - Intergenic
936103399 2:109603375-109603397 CAGGCACACACCGCCACGCCTGG + Intronic
936329822 2:111537893-111537915 CAGGTGCACACCACCACGCCCGG + Intergenic
936356795 2:111758853-111758875 CAGGTGCACACCACCACGCCTGG + Intergenic
937147659 2:119661194-119661216 CAGGTACACACCACCACGCCTGG - Intronic
937344336 2:121115046-121115068 CAGGCACACACCGCCACGCCCGG + Intergenic
937384975 2:121421388-121421410 CAGGTGCACACCGCCATGCCCGG + Intronic
937903605 2:127040867-127040889 CAGGTGCACACCACCACGCCCGG + Intergenic
937979085 2:127602855-127602877 CCGGTGCACATCACCACGCCCGG - Intronic
938910173 2:135878289-135878311 CAGGCGCACACCGCCACGCCCGG + Intergenic
939473701 2:142658289-142658311 CAGGTACACACCACCACGCCTGG - Intergenic
939529184 2:143336149-143336171 CAGCAGCACACCGCCACACCTGG + Intronic
939908566 2:147950620-147950642 CAGCCACACACCGCCATGCCTGG - Intronic
940181853 2:150942831-150942853 CAGGTGCACACCACCACGCCCGG - Intergenic
940929910 2:159415300-159415322 CAGGTGCACACCACCACGCCCGG - Intronic
941363791 2:164585062-164585084 CCCCTTCATACCACCATGCCTGG + Intronic
941393214 2:164942290-164942312 CAGGTGCACACCACCACGCCCGG - Intronic
941725312 2:168854008-168854030 CAGGTGCACACCACCACGCCCGG + Intronic
941878714 2:170460343-170460365 CAGCTGCACACCACCACGCCTGG - Intronic
942273103 2:174296980-174297002 CAGGTGCACACCACCACGCCTGG - Intergenic
942283595 2:174391445-174391467 CAGATACACACCACCACGCCTGG - Intronic
942650802 2:178165330-178165352 CAGGTGCACACCACCACGCCTGG + Intergenic
942877145 2:180814474-180814496 CCGGTGCACACCACCATGCCTGG - Intergenic
943463223 2:188195715-188195737 CAGGTGCACACCACCACGCCTGG + Intergenic
943565621 2:189512906-189512928 CAGATGCACACCACCACGCCTGG + Intergenic
943701022 2:190988519-190988541 CCGGTGCACACCACCACACCTGG + Intronic
943875133 2:193057890-193057912 CAGGTGCCCACCGCCACGCCTGG - Intergenic
944240897 2:197484053-197484075 CCGGTGCACACCACCATGCCTGG - Intergenic
944497724 2:200325519-200325541 CAGGTGCACACCACCACGCCTGG + Intronic
944853387 2:203743206-203743228 CCGCCACCCACCACCACGCCTGG + Intergenic
944884595 2:204049448-204049470 CAGGTGCACACCGCCATGCCTGG - Intergenic
945881046 2:215325703-215325725 CAGGTGCACACCACCACGCCTGG + Intronic
945907377 2:215610284-215610306 CAGCTGCACACCACCACACCTGG + Intergenic
946223760 2:218250976-218250998 CAGGTGCACACCACCACGCCCGG + Intronic
946260872 2:218489620-218489642 CAGGTGCACACCACCACGCCTGG + Intronic
946392960 2:219427291-219427313 CAGGTTCACACCACCATGCCTGG + Intergenic
946647550 2:221854219-221854241 CAGTTTCACACCACCACGTCTGG + Intergenic
947019926 2:225663698-225663720 CAGGTGCACACCACCACGCCTGG + Intergenic
947561493 2:231157707-231157729 CAGGTGCACACCGCCATGCCCGG + Intronic
947583812 2:231339183-231339205 CAGATGCACACCACCACGCCTGG - Intronic
948355065 2:237371453-237371475 CAGGTTCATACCACCACGCCCGG - Intronic
948381351 2:237551834-237551856 CAGGTTCACACCACCATGCCTGG - Intronic
949006550 2:241652637-241652659 CAGGTGCACACCACCACGCCTGG + Intronic
1168897179 20:1331624-1331646 CAGGTTCACACTGCCACACCTGG + Intronic
1168914410 20:1474713-1474735 CAGGTGCACACCACCACGCCTGG + Exonic
1169117713 20:3076524-3076546 CAGGTGCACACCACCACGCCCGG - Intergenic
1169133701 20:3182712-3182734 CAGGTGCACACCACCACGCCTGG + Intergenic
1169242827 20:3998935-3998957 CAGGTGCACACCACCACGCCCGG - Intronic
1169374329 20:5054353-5054375 CAGGTGCACACCACCACGCCCGG - Intergenic
1169378511 20:5086840-5086862 CAGATGCACACTGCCACGCCTGG + Intronic
1169447125 20:5681688-5681710 CCGGTGCACACCACAACGCCTGG + Intergenic
1169687803 20:8295850-8295872 CAGTTGCACACCACCACGCCTGG + Intronic
1170630880 20:18063850-18063872 CAGGTGCACACCGCCATGCCCGG - Intergenic
1170691454 20:18619565-18619587 CAGGTGCACACCGCCACGCCTGG + Intronic
1171995126 20:31724987-31725009 CAGGTACACACCACCACGCCCGG + Intergenic
1172057335 20:32163752-32163774 CAGGTGCACACCACCACGCCCGG + Intronic
1172106486 20:32520141-32520163 CAGGTGCCCACCGCCACGCCTGG - Intronic
1172166997 20:32905615-32905637 CAGGTACACACCACCACGCCTGG - Intronic
1172255277 20:33512194-33512216 CGCCTGCACACCGCCATGCCCGG - Intronic
1172377396 20:34455603-34455625 CAGGTGCACACCGCCATGCCTGG + Intronic
1172478133 20:35254009-35254031 CAGACTCACACCACCACGCCTGG + Intronic
1172515970 20:35533669-35533691 CAGGCACACACCGCCACGCCTGG - Intergenic
1172549596 20:35788718-35788740 CCGGTGTACACCACCACGCCTGG + Intronic
1172685602 20:36751602-36751624 CAAGTGCACACCGCCACGCCCGG + Intergenic
1172744253 20:37194402-37194424 CAGGTGCACACCCCCACGCCTGG + Intronic
1172762609 20:37332896-37332918 CAGGTGCACACCACCACGCCTGG + Intergenic
1172854621 20:37992417-37992439 CAGGTGCACACCACCACGCCTGG + Intronic
1173508123 20:43605402-43605424 CAGGTGCACACCACCACGCCTGG - Intronic
1173965825 20:47111996-47112018 CAGGTGCACACCACCACGCCTGG - Intronic
1174043994 20:47720396-47720418 CAGGTGCACACCACCACGCCCGG + Intronic
1174372397 20:50100440-50100462 CAGGTGCACACCACCACGCCCGG - Intronic
1174447610 20:50601289-50601311 CAGGTGCACACCACCACGCCTGG - Intronic
1174473938 20:50782630-50782652 CAGGTGCACACCGCCATGCCTGG + Intergenic
1174628569 20:51936353-51936375 CAGGTGCACACCACCACGCCTGG - Intergenic
1174771623 20:53305833-53305855 CAGGTGCACACCGCCATGCCTGG - Intronic
1174780291 20:53383118-53383140 CAGGTGCACACCGCCACCCCCGG - Intronic
1174815348 20:53682479-53682501 CCGGTGCACACCACCACGCCTGG + Intergenic
1175070361 20:56328056-56328078 CAGGTCCACACCCCCACGCCTGG - Intergenic
1175239954 20:57539719-57539741 CAGGTGCACACCACCACGCCTGG + Intergenic
1176006505 20:62866739-62866761 CAGGTTCACGCCACCACGCCCGG - Intergenic
1176165912 20:63673579-63673601 CAGGTGCACACCACCACGCCCGG + Intronic
1176852189 21:13929099-13929121 CAGGTGCACACCACCACGCCTGG + Intergenic
1177007403 21:15690569-15690591 CAGCTGCACACCACCACGTCTGG - Intergenic
1177180987 21:17744797-17744819 CAGGTACACACCGCCACGCCCGG - Intergenic
1178269287 21:31175083-31175105 CCGGTGCACACCACCACGCCTGG + Intronic
1178328407 21:31664112-31664134 CAGGTACACACCACCACGCCTGG + Intronic
1178397563 21:32255746-32255768 CAGGCGCACACCGCCACGCCTGG - Intergenic
1178507496 21:33174516-33174538 CAGGTGCACACCACCACGCCTGG - Intergenic
1178723447 21:35030198-35030220 CAGGTGCACACCGCCATGCCCGG - Intronic
1178953219 21:37002571-37002593 CAGGTGCACACCACCACGCCTGG + Intergenic
1179070726 21:38068453-38068475 CAGGTGCACACCACCACGCCTGG + Intronic
1179393553 21:41016119-41016141 CAGCTGCACACCACCACACCTGG - Intergenic
1179618314 21:42595881-42595903 CTGCCTCACACTGCCACGCCTGG - Intergenic
1179838111 21:44051044-44051066 CAGGTGCACACCGCCATGCCCGG + Intronic
1179989432 21:44939561-44939583 CCGGTGGGCACCGCCACGCCCGG - Intronic
1180012299 21:45058973-45058995 CAGGTTCGCACCACCACGCCTGG - Intergenic
1181563874 22:23722075-23722097 CAGATGCACACCACCACGCCCGG - Intergenic
1181753187 22:25004256-25004278 CAGGTACACACCACCACGCCTGG + Intronic
1181834742 22:25594733-25594755 CAGGTGCCCACCGCCACGCCCGG - Intronic
1182286420 22:29251058-29251080 CAGGTACACACCACCACGCCTGG + Intronic
1182300414 22:29333920-29333942 CAGGTGCACACCACCACGCCTGG - Intronic
1182334185 22:29572158-29572180 CAGGTGCACACCACCACGCCTGG - Intronic
1182484805 22:30633042-30633064 CAGGTTCACGCCACCACGCCCGG - Intergenic
1182852205 22:33485052-33485074 CAGGTTCCCACCACCACGCCCGG + Intronic
1182939843 22:34265060-34265082 CAGGTGCACACCACCACGCCTGG - Intergenic
1183196644 22:36358205-36358227 CAGGTGCACACCGCCACACCCGG + Intronic
1183375135 22:37459679-37459701 CAGGTGCACACCACCACGCCTGG + Intergenic
1183465245 22:37977023-37977045 CAGGTGCACACCGCCACGTCTGG - Intronic
1183637549 22:39073640-39073662 CAGGTGCACACCACCACGCCCGG - Intronic
1183717381 22:39541446-39541468 CAGGTGCACACCACCACGCCTGG + Intergenic
1183762037 22:39830216-39830238 CAGGTACACACCACCACGCCCGG + Intronic
1183997297 22:41644626-41644648 CAGATGCACACCGCCACGCCTGG + Intronic
1184156649 22:42671921-42671943 CAGGTGCACGCCGCCACGCCTGG - Intergenic
1184228117 22:43142342-43142364 CAGGTGCACACCACCACGCCCGG - Intronic
1184340570 22:43883666-43883688 CAGGTGCCCACCGCCACGCCCGG - Intronic
1184350304 22:43939066-43939088 CAGGTGCACACCACCACGCCTGG + Intronic
1184635548 22:45825917-45825939 CAGGTGCACACCACCACGCCTGG - Intronic
1184641304 22:45872137-45872159 CAGGTGCACACCACCACGCCTGG - Intergenic
1184696475 22:46142167-46142189 CAGGTGCACACCACCACGCCTGG + Intergenic
1184945819 22:47803073-47803095 CGGGTGCACACCACCACGCCTGG + Intergenic
1184980545 22:48092367-48092389 CAGGTGCACACCACCACGCCTGG - Intergenic
1185069584 22:48648693-48648715 CTGGTGCACACCACCACGCCCGG - Intronic
1185340045 22:50287111-50287133 CCCCGTCACACCGCCAGGCCAGG - Exonic
949140816 3:630591-630613 CAGGTGCACACCACCACGCCTGG - Intergenic
949745113 3:7281938-7281960 CAGCCTCACGCTGCCACGCCCGG - Intronic
949776138 3:7634649-7634671 CAGGCGCACACCGCCACGCCCGG - Intronic
950017317 3:9763240-9763262 CAGGTGCACACCGCCATGCCTGG - Intronic
950056777 3:10031358-10031380 CAGGTGCACACCACCACGCCCGG - Intronic
950087697 3:10272245-10272267 CAGGTGCACACCACCACGCCTGG + Intronic
950381323 3:12617748-12617770 CAGGCACACACCGCCACGCCTGG - Intronic
950439632 3:13001914-13001936 CAGGTGCACACCACCACGCCTGG - Intronic
950804654 3:15589352-15589374 CAGGTTCACACCACCATGCCTGG - Intronic
951689700 3:25382713-25382735 CAGGTGCACACCGCCACACCCGG - Intronic
952378619 3:32787214-32787236 CAGGTGCCCACCGCCACGCCCGG - Intergenic
952418028 3:33107257-33107279 CAGGTGCACACCACCACGCCTGG - Intergenic
952529730 3:34251114-34251136 CAGGTGCACACCACCACGCCTGG + Intergenic
953654711 3:44840809-44840831 CAGGTGCACACTGCCACGCCTGG + Intronic
953694894 3:45149869-45149891 CAGTTGCACACCACCACGCCTGG + Intergenic
954055336 3:48018658-48018680 CAGGTGCACACCACCACGCCCGG - Intronic
954168637 3:48781482-48781504 CAGGTGCACACCACCACGCCCGG + Intronic
954626945 3:52027452-52027474 CAGGTGCACGCCGCCACGCCCGG - Intergenic
954722100 3:52573434-52573456 CAGGTGCACACCACCACGCCCGG + Intronic
954795769 3:53160874-53160896 CCGCTCCCCACACCCACGCCCGG - Intronic
955196221 3:56807024-56807046 CAGGTACACACCACCACGCCCGG + Intronic
955337716 3:58100736-58100758 CAGGTGCACACCACCACGCCTGG + Intronic
955432307 3:58860032-58860054 CAGGTACACACCACCACGCCTGG - Intronic
956040628 3:65141551-65141573 CAGGTGCACACCACCACGCCCGG + Intergenic
956820976 3:72953946-72953968 CAGCTACACACCACCATGCCTGG - Intronic
956854483 3:73262502-73262524 CAGGTGCACACCACCACGCCTGG + Intergenic
957153231 3:76513496-76513518 CAGGCTCACACCACCACGCCTGG + Intronic
957257175 3:77853135-77853157 CAGATGCACACCACCACGCCTGG + Intergenic
957635447 3:82777898-82777920 CAGGTGCCCACCGCCACGCCCGG - Intergenic
957702771 3:83739006-83739028 CAGGTGCACACCACCACGCCCGG - Intergenic
957795158 3:84994883-84994905 CAGGTGCACACCACCACGCCCGG - Intronic
958264229 3:91418809-91418831 CAGGTGCACACCACCACGCCTGG + Intergenic
958785742 3:98594326-98594348 CAGGTGCACGCCGCCACGCCCGG - Intergenic
958799460 3:98738414-98738436 CAGATACACACCGCCACACCCGG + Intronic
959538074 3:107509561-107509583 CAGGTGCACACCACCACGCCTGG + Intergenic
960648988 3:119925184-119925206 CAGGTGCACACCACCACGCCTGG - Intronic
960970190 3:123134164-123134186 CAGGTGCACACCGCCACACCTGG + Intronic
961013787 3:123451820-123451842 CAGGCTCACACCGCCACGCCCGG - Intergenic
961205914 3:125081455-125081477 CAGGTACACACCACCACGCCTGG - Intergenic
961296428 3:125888563-125888585 CAGGTGCACACCACCACGCCCGG - Intergenic
961366733 3:126404815-126404837 CAGGTGCACACCACCACGCCTGG + Intronic
961566710 3:127769206-127769228 CAGGTGCACACCACCACGCCTGG - Intronic
962216713 3:133528854-133528876 CAGGTGCACACCACCACGCCTGG - Intergenic
962286803 3:134093246-134093268 CGGGTGCACACCACCACGCCCGG + Intronic
962733156 3:138301344-138301366 CAGGTGCACACCACCACGCCCGG + Intronic
963565310 3:146921927-146921949 CGGCTGCACACCGCTACTCCCGG + Intergenic
963745647 3:149122249-149122271 CAGGCGCACACCGCCACGCCTGG + Intergenic
963777810 3:149457482-149457504 CAGGTGCACACCACCACGCCCGG - Intergenic
963783575 3:149510893-149510915 CAGGTGCACACCACCACGCCCGG + Intergenic
963895542 3:150681955-150681977 CAGGTGCACACCGCCATGCCCGG + Intronic
964000834 3:151769893-151769915 CAGGTGCACACCACCACGCCTGG - Intergenic
965178931 3:165375303-165375325 CAGGCTCACACCACCACGCCTGG + Intergenic
965385391 3:168039404-168039426 CAGGTGCACACCACCACGCCTGG + Intronic
965555137 3:170010921-170010943 CAGGTGCACACCACCACGCCTGG + Intergenic
966406755 3:179605932-179605954 CAGGTGCACACCACCACGCCTGG + Intronic
966736661 3:183192279-183192301 CAGGTGCACACCACCACGCCCGG + Intronic
966857960 3:184208614-184208636 CTGGTGCACACCACCACGCCTGG - Intronic
966934297 3:184695610-184695632 CAGCTGCACACCACCACGCCTGG - Intergenic
966940702 3:184744936-184744958 CAGGCGCACACCGCCACGCCCGG - Intergenic
967645423 3:191917341-191917363 CAGGTGCACACCACCACGCCCGG - Intergenic
967852680 3:194093949-194093971 CTGCCTCACACTGCCACGCAGGG - Intergenic
968150510 3:196334594-196334616 CAGCTGCACACCACCATGCCCGG + Intronic
968219236 3:196922762-196922784 CCAGTGCACACCACCACGCCCGG + Intronic
968580791 4:1393410-1393432 CAGGTGCACACCACCACGCCCGG - Exonic
968919089 4:3513448-3513470 CAGGTGCCCACCGCCACGCCCGG + Intronic
969045522 4:4333858-4333880 CTGGTGCACACCACCACGCCTGG - Intergenic
969431853 4:7159868-7159890 CGGGTACACACCACCACGCCTGG + Intergenic
969550871 4:7866336-7866358 CAGCTGCACACCACCACACCCGG + Intronic
969955977 4:10891157-10891179 CAGGTGCACACCACCACGCCTGG + Intergenic
970577202 4:17438962-17438984 CAGGTACACACCACCACGCCCGG + Intergenic
970587448 4:17528109-17528131 CAGGTGCACACCGCCACGGCAGG - Intergenic
970841531 4:20477339-20477361 CAGGTGCCCACCGCCACGCCTGG + Intronic
971205504 4:24563922-24563944 CAGCTGCCCACCACCACGCCCGG - Intronic
971238222 4:24863148-24863170 CGGGTGCATACCGCCACGCCCGG - Intronic
971271789 4:25156563-25156585 CAGGTGCCCACCGCCACGCCTGG - Intronic
971306367 4:25485719-25485741 CAGTTGCACACCACCACGCCTGG + Intergenic
971636250 4:29062582-29062604 CAGGTTCACACCACCACACCCGG + Intergenic
971717534 4:30198881-30198903 CAGCTGCGCACCACCACGCCTGG + Intergenic
971795077 4:31216881-31216903 CAGGTGCACACTGCCACGCCTGG - Intergenic
972306039 4:37831049-37831071 CAGGTGCACACCACCACGCCTGG - Intronic
972422781 4:38905254-38905276 CAGATGCACACCACCACGCCCGG - Intronic
972439964 4:39078550-39078572 CAGGTTCACGCCACCACGCCTGG - Intronic
972565888 4:40268575-40268597 CAGGTGCACACCACCACGCCCGG - Intergenic
972630478 4:40837421-40837443 GCGCCTCACACAGCCACGCAGGG + Intronic
972695793 4:41445146-41445168 CAGGTGCACACCGCCACGCCTGG + Intronic
973766618 4:54168821-54168843 CTGGTGCACACCACCACGCCCGG - Intronic
974064005 4:57060774-57060796 CAGGTGCACACCACCACGCCTGG - Intronic
974145503 4:57942680-57942702 CAGGTGCACACCGTCACGCCCGG - Intergenic
974579145 4:63772202-63772224 CAGGTGCACACCGCCACGCCCGG - Intergenic
975632048 4:76414049-76414071 CAGCTGCACACCACCATGCCTGG + Intronic
975638155 4:76471384-76471406 CAGGTGCACACCACCACGCCTGG + Intronic
975704327 4:77097066-77097088 CAGGTGCACACCACCACGCCCGG - Intergenic
975795094 4:77998548-77998570 CAGGTGCCCACCGCCACGCCTGG + Intergenic
976193107 4:82507887-82507909 CAGCTGCACACCACCACACCTGG + Intronic
976235048 4:82888231-82888253 CAGGTACACACCACCACGCCCGG - Intronic
977341339 4:95762605-95762627 CAGGTTCACACCACCATGCCTGG + Intergenic
977595440 4:98874410-98874432 CAGCTGCGCACCACCACGCCTGG + Intronic
978795698 4:112705837-112705859 CCCCTTCCCAGCGCCGCGCCCGG - Intergenic
978965625 4:114737359-114737381 CAGGTGCACACCGCCATGCCCGG - Intergenic
978990175 4:115070960-115070982 CAGGTGCACACCACCACGCCTGG - Intronic
979239071 4:118432418-118432440 CAGGTACACACCACCACGCCTGG - Intergenic
979867219 4:125771743-125771765 CAGGTACACACCACCACGCCCGG + Intergenic
979960803 4:127019178-127019200 CAGCTGCACACCACCACACCTGG + Intergenic
980144842 4:128969427-128969449 CAGGTGCACGCCGCCACGCCTGG - Intronic
980337801 4:131499191-131499213 CAGCTGCACACCACCATGCCTGG + Intergenic
980536471 4:134129920-134129942 CAGGTGCACACCACCACGCCTGG - Intergenic
981175941 4:141683426-141683448 CAGGTGCACACCGCCATGCCAGG - Intronic
981302510 4:143204530-143204552 CAGGTGCACACCACCACGCCAGG + Intronic
981473981 4:145169625-145169647 CAGGTGCACACCACCACGCCTGG + Intronic
982154433 4:152503410-152503432 CAGATGCACACCACCACGCCCGG + Intronic
982227320 4:153177942-153177964 CAGGTGCACACCACCACGCCTGG + Intronic
982252654 4:153422976-153422998 CAGGTTCACACCACCACGCCCGG - Intergenic
982585442 4:157231179-157231201 CAGGTGCACACCGCCACGCCTGG + Intronic
982932076 4:161421196-161421218 CAGGTGCACACCACCACGCCCGG - Intronic
983651765 4:170042953-170042975 CAGCTGCACACCACCATGCCAGG + Intergenic
984444982 4:179825159-179825181 CAGCAGCACACCGCCATGCCTGG + Intergenic
984912752 4:184689593-184689615 CAGGTGCCCACCGCCACGCCTGG + Intronic
984969728 4:185177268-185177290 CAGGTGCACACCGCCAAGCCAGG - Intronic
985753760 5:1700757-1700779 CAGGCACACACCGCCACGCCTGG - Intergenic
985876107 5:2597121-2597143 CAGGTGCACACCACCACGCCCGG - Intergenic
986707770 5:10465707-10465729 CAGGTGCCCACCGCCACGCCTGG - Intronic
986788608 5:11139101-11139123 CAGCTGCACACCACCATGCCAGG + Intronic
986894880 5:12353519-12353541 CAGGTGCACACCGCCCCGCCTGG + Intergenic
987115581 5:14724172-14724194 CAGGTGCACACCACCACGCCTGG - Intronic
987706780 5:21469037-21469059 CAGGTGCACACCGCCACACCTGG + Intergenic
988146421 5:27314541-27314563 CAGGTGCACACCACCACGCCTGG - Intergenic
988176236 5:27729567-27729589 CAGCTACCCGCCGCCACGCCTGG - Intergenic
988197557 5:28024924-28024946 CAGGCGCACACCGCCACGCCCGG - Intergenic
988475808 5:31584471-31584493 CAGGTGCACACCACCACGCCCGG - Intergenic
988612653 5:32741866-32741888 CAGGTGCACACCACCACGCCTGG + Intronic
988775874 5:34477751-34477773 CTGTTTCACAGCGCCACGTCTGG - Intergenic
988840012 5:35074317-35074339 CAGGTGCACACCACCACGCCTGG - Intronic
989049538 5:37305727-37305749 CAGGTGCACACCGCCACGCCTGG - Intronic
989049701 5:37307053-37307075 CAGGTGCACACCACCACGCCTGG - Intronic
989058745 5:37389233-37389255 CAGGTGCACACCGCCACGCCTGG + Intronic
989077954 5:37585131-37585153 CAGGTGCACACCACCACGCCTGG + Intronic
989160484 5:38386334-38386356 CAGGTGCACACCACCACGCCTGG + Intronic
989380353 5:40804210-40804232 CAGGTACACACCGCCATGCCTGG - Intergenic
989795464 5:45465610-45465632 CAGGTGCCCACCGCCACGCCCGG - Intronic
990428742 5:55713573-55713595 CAGGTGCACACCACCACGCCTGG - Intronic
990882404 5:60554651-60554673 CAGGTTCACACCACCACTCCCGG + Intergenic
991037378 5:62141487-62141509 CAGGTTCACACCACCATGCCTGG - Intergenic
991249702 5:64546009-64546031 CAGGTGCACACCACCACGCCTGG - Intronic
991406273 5:66303714-66303736 CAGGTGCACACCACCACGCCCGG + Intergenic
991769249 5:70025457-70025479 CCGCTTCCCACCCCCACTCACGG - Exonic
991848544 5:70900875-70900897 CCGCTTCCCACCCCCACTCACGG - Exonic
991905222 5:71503127-71503149 CAGGCTCACACCACCACGCCTGG + Intronic
991927345 5:71718813-71718835 CCCCTTCTCACCGCCACACTTGG + Intergenic
992009948 5:72516144-72516166 CAGCTGCCCACCGCCACACCCGG + Intergenic
992450649 5:76872828-76872850 CAGGTTCACACCACCATGCCTGG - Intronic
993976567 5:94489741-94489763 CAGGTGCACACCACCACGCCTGG - Intronic
994487947 5:100402647-100402669 CAGGCACACACCGCCACGCCCGG - Intergenic
995108014 5:108397639-108397661 CAGGTGCACACCACCACGCCAGG + Intergenic
995512938 5:112926076-112926098 CAGGTGCACACCACCACGCCTGG + Intergenic
995524169 5:113037548-113037570 CAGGTGCACACCACCACGCCTGG - Intronic
995719270 5:115113002-115113024 CAGGTGCACACCACCACGCCTGG + Intergenic
995993984 5:118277497-118277519 CAGGTGCACACCACCACGCCTGG + Intergenic
996380389 5:122857152-122857174 CAGGTGCACACCACCACGCCCGG + Intronic
996531752 5:124534353-124534375 CAGGTTCACACCACCACACCTGG + Intergenic
996779819 5:127172863-127172885 CCCCTTCACCCCTCCACCCCAGG + Intergenic
996836164 5:127795145-127795167 CAGGCTCACACCACCACGCCTGG - Intergenic
997324133 5:133005469-133005491 CAGATGCACACCACCACGCCTGG - Intronic
997916531 5:137932203-137932225 CAGGTGCACACCACCACGCCTGG - Intronic
997929219 5:138058660-138058682 CAGGTGCACACCACCACGCCTGG - Intergenic
997969368 5:138387936-138387958 CAGGTGCACGCCGCCACGCCCGG - Intronic
998018266 5:138750236-138750258 CAGGTGCACACCACCACGCCCGG - Intronic
998273718 5:140731590-140731612 CAGGTGCACACCGCCACGCCCGG + Intergenic
998355247 5:141529939-141529961 CAGGTGCACACCACCACGCCTGG - Intronic
998425978 5:142028961-142028983 CAGGTGCACACCACCACGCCTGG - Intergenic
998478120 5:142438467-142438489 CAGATACACACCACCACGCCTGG - Intergenic
998486019 5:142502992-142503014 CAGGTGCACACCACCACGCCTGG - Intergenic
998837364 5:146215891-146215913 CAGGTGCACACCACCACGCCTGG + Intronic
999736240 5:154515419-154515441 CAGGTGCCCACCGCCACGCCCGG - Intergenic
1000344696 5:160304954-160304976 CAGGTGCACACCACCACGCCCGG + Intronic
1000629779 5:163579252-163579274 CAGGTGCACACCGCCACGCCTGG + Intergenic
1001625169 5:173126281-173126303 CAGGTGCACACCACCACGCCCGG + Intronic
1001841437 5:174880232-174880254 CAGCTGCCCACCACCACGCCTGG - Intergenic
1001892878 5:175353756-175353778 CCGTTCCACACCACCACTCCTGG - Intergenic
1002017343 5:176335417-176335439 CAGGTGCACACCACCACGCCTGG + Intronic
1002109914 5:176901592-176901614 CAGGTGCACACCACCACGCCCGG - Intergenic
1002361310 5:178673478-178673500 CAGGTGCCCACCGCCACGCCTGG - Intergenic
1002397652 5:178970602-178970624 CAGGTTCCCACCACCACGCCCGG + Intergenic
1002557944 5:180058696-180058718 CAGGTGCACACCACCACGCCTGG + Intronic
1002739319 5:181423016-181423038 CAGGTACACACCACCACGCCTGG - Intergenic
1003058937 6:2847535-2847557 CAGGTGCACACCACCACGCCTGG - Intergenic
1003078852 6:3004935-3004957 CAGGTGCACACCACCACGCCCGG + Intronic
1003110853 6:3251111-3251133 CAGGTGCACACCACCACGCCTGG + Intronic
1004095291 6:12548198-12548220 CAGGTGCACACCACCACGCCCGG - Intergenic
1004235013 6:13867690-13867712 CAGGTGCACACCACCACGCCTGG + Intergenic
1004537248 6:16514838-16514860 CAGCCTCCCACCACCACGCCTGG - Intronic
1004702625 6:18093250-18093272 CAGGTGCACACCACCACGCCTGG + Intergenic
1004789969 6:19014605-19014627 CAGGTGCACACCACCACGCCTGG + Intergenic
1005085557 6:22002993-22003015 CAGGTGCACACCACCACGCCTGG - Intergenic
1005262053 6:24071671-24071693 CAGGTGCACACCACCACGCCTGG - Intergenic
1005383009 6:25256536-25256558 CAGGTGCACACCACCACGCCTGG - Intergenic
1005456186 6:26021794-26021816 CCGCTTCACACCGCCACGCCGGG - Exonic
1005477036 6:26217982-26218004 CAGATGCACACCACCACGCCCGG - Intergenic
1005480015 6:26246840-26246862 GCGCTTGACACCGCCATGCCGGG + Exonic
1005642202 6:27807142-27807164 GCGTTTGACACCGCCAGGCCAGG - Intergenic
1005668875 6:28084514-28084536 CAGATGCACACCGCCACACCTGG - Intronic
1005934894 6:30513669-30513691 CAGATGCACACCGCCATGCCTGG + Intergenic
1005966282 6:30728922-30728944 CAGGCACACACCGCCACGCCCGG + Intronic
1006014800 6:31071614-31071636 CAGGTGCACACCACCACGCCTGG - Intergenic
1006123803 6:31824410-31824432 CAGGTGCACACCACCACGCCTGG - Intergenic
1006356703 6:33563428-33563450 CAGGTGCACACCACCACGCCCGG + Intergenic
1006945393 6:37781055-37781077 CAGGTGCACACCACCACGCCCGG + Intergenic
1006977847 6:38120466-38120488 CAGGTGCACACCTCCACGCCTGG + Intronic
1007011698 6:38424657-38424679 CTGGTGCACACCACCACGCCGGG + Intronic
1007148522 6:39663034-39663056 CAGGTGCACACCGCCATGCCTGG + Intronic
1007416944 6:41696549-41696571 CAGGTGCACACCACCACGCCCGG - Intronic
1007871645 6:45046471-45046493 CAGCTGTACACCACCACGCCAGG + Intronic
1008912375 6:56749209-56749231 CAGGTGCACACCACCACGCCTGG - Intronic
1009021443 6:57951455-57951477 CAGGTGCACACCGCCATGCCTGG - Intergenic
1009279773 6:61733450-61733472 CAGGTGCACACCACCACGCCTGG - Intronic
1009292860 6:61905988-61906010 CCGGTGCCCACCACCACGCCTGG + Intronic
1009512425 6:64569596-64569618 CAGGTTCCCACCACCACGCCTGG - Intronic
1009609560 6:65923100-65923122 CAGGTGCACGCCGCCACGCCCGG + Intergenic
1010103360 6:72137877-72137899 CAGGTGCCCACCGCCACGCCCGG + Intronic
1010113485 6:72271121-72271143 CAGGTGCACACCGCCACGCCTGG - Intronic
1010641229 6:78330620-78330642 CAGGTGCACACCACCACGCCTGG + Intergenic
1011647998 6:89478589-89478611 CAGGTGCACACCACCACGCCTGG - Intronic
1012657170 6:101838792-101838814 CAGCTGCCCACCACCACGCCTGG + Intronic
1013157505 6:107507446-107507468 CAGCTGCTCACCACCACGCCTGG + Intronic
1013780757 6:113726264-113726286 CAGGTGCACACCACCACGCCTGG + Intergenic
1013875482 6:114821434-114821456 CAGGTGCACACCGCCACACCCGG + Intergenic
1014447184 6:121542180-121542202 CAGATACACACCACCACGCCTGG + Intergenic
1014515364 6:122371345-122371367 CAGGTGCACACCACCACGCCTGG - Intergenic
1014782085 6:125575914-125575936 CCACCACACACCACCACGCCCGG + Intergenic
1015102070 6:129493010-129493032 CAGGTGCACACCGCCATGCCAGG - Intronic
1015250411 6:131121615-131121637 CAGGTGCACACCACCACGCCTGG + Intergenic
1015295774 6:131590759-131590781 CAGGTGCACACCACCACGCCTGG + Intronic
1015305472 6:131701737-131701759 CAGGTACACGCCGCCACGCCGGG - Intronic
1015319761 6:131859526-131859548 CAGGTGCACACCACCACGCCCGG + Intronic
1015363899 6:132375566-132375588 CAGGTGCCCACCGCCACGCCTGG + Intronic
1015537818 6:134284233-134284255 CAGGTGCACACCACCACGCCTGG + Intronic
1015546813 6:134369825-134369847 CAGGTGCACACCACCACGCCTGG - Intergenic
1015859710 6:137662610-137662632 CAGGTGCACACCACCACGCCTGG - Intergenic
1016029338 6:139321772-139321794 CAGTTTCCCACCACCACGCCTGG + Intergenic
1016442252 6:144096035-144096057 CAGTTGCACACCACCACGCCCGG + Intergenic
1016549267 6:145258630-145258652 CAGATGCACACCACCACGCCTGG - Intergenic
1016955587 6:149623593-149623615 CAGGTGCACACCACCACGCCTGG - Intronic
1016962254 6:149685093-149685115 CAGGTGCACACCACCACGCCTGG - Intronic
1017161502 6:151369828-151369850 CAGCTGCGCACCACCACGCCCGG - Intronic
1017246548 6:152233465-152233487 CAGGCGCACACCGCCACGCCAGG + Intronic
1017698945 6:157049029-157049051 CAGCTGCCCACCACCACGCCTGG - Intronic
1018006879 6:159630602-159630624 CAGGTTCCCACCACCACGCCTGG - Intergenic
1018768771 6:166954847-166954869 CAGATGCACACCACCACGCCTGG - Intronic
1018778508 6:167041964-167041986 CAGGTGCACACCACCACGCCCGG + Exonic
1018817885 6:167349471-167349493 CAGGTGCACACCCCCACGCCTGG - Intronic
1019244430 6:170698575-170698597 CAGGTACACACCACCACGCCTGG - Intergenic
1019379989 7:716188-716210 CAGGTGCACACCGCCACACCTGG + Intronic
1019817464 7:3211659-3211681 CAGGTACACACCACCACGCCTGG + Intergenic
1020036142 7:4964247-4964269 CAGATGCACACCACCACGCCTGG - Intergenic
1020040878 7:4999938-4999960 TAGGTTCACACCACCACGCCTGG - Intronic
1020122913 7:5515320-5515342 CAGGTGCACACCACCACGCCTGG - Intergenic
1020182848 7:5935616-5935638 CAGGTGCACACCGCCACACCTGG - Intronic
1020197313 7:6051412-6051434 CAGGTGCACACCACCACGCCTGG + Intronic
1020233033 7:6334607-6334629 CAGGTGCACACCGCCACGCCCGG + Intronic
1020300064 7:6789141-6789163 CAGGTGCACACCGCCACACCTGG + Intronic
1021155352 7:17203255-17203277 CAGGTGCACACCACCACGCCTGG - Intergenic
1021551311 7:21873931-21873953 CAGCTGCATACCACCACGCCCGG + Intronic
1021657624 7:22887681-22887703 CAGGTGCACACCACCACGCCCGG - Intergenic
1021734683 7:23631616-23631638 CAGGTGCACACCACCACGCCCGG - Intronic
1022006893 7:26273927-26273949 CAGCTGCCCGCCGCCACGCCTGG - Intergenic
1022077848 7:26991146-26991168 CAGCTGCACACCACCAGGCCTGG - Intronic
1022080506 7:27015408-27015430 CAGCTGCACACCACCAGGCCTGG + Intergenic
1022168094 7:27792818-27792840 CAGCTGCACACCACCACACCTGG - Intronic
1022194537 7:28051360-28051382 CAGGTGCACACCACCACGCCTGG + Intronic
1022724963 7:32972863-32972885 CAGGTGCACACCACCACGCCTGG + Intronic
1022816649 7:33920566-33920588 CAGGTGCACACCACCACGCCTGG + Intronic
1022864807 7:34406512-34406534 CAGGTGCACACCACCACGCCTGG + Intergenic
1023071848 7:36442772-36442794 CAGATGCTCACCGCCACGCCTGG + Intronic
1023775176 7:43598903-43598925 CAGGTGCACACCACCACGCCTGG + Intronic
1023783584 7:43682989-43683011 CAGGTGCCCACCGCCACGCCTGG + Intronic
1023939134 7:44758937-44758959 CAGGTGCACACCACCACGCCCGG - Intronic
1023964248 7:44954113-44954135 CAGGTGCACACCACCACGCCTGG + Intergenic
1024033822 7:45489253-45489275 CAGGTGCACACCACCACGCCCGG + Intergenic
1024076543 7:45822228-45822250 CAGGTGCACACCGTCACGCCTGG - Intergenic
1024265527 7:47603428-47603450 CAGGTGCACACCACCACGCCTGG - Intergenic
1024288382 7:47780487-47780509 CAGGTGCACACCACCACGCCTGG - Intronic
1024368957 7:48558437-48558459 CAGGTGCACACCACCACGCCTGG + Intronic
1024391775 7:48821905-48821927 CAGGTGCACACCACCACGCCCGG + Intergenic
1024914920 7:54488432-54488454 CTGCTTCACACCTCCAGGACTGG - Intergenic
1025048638 7:55714971-55714993 CAGGTGCACACCACCACGCCTGG - Intergenic
1025060502 7:55802145-55802167 CAGCCGCACACCACCACGCCCGG + Intronic
1025116893 7:56266045-56266067 CAGGTGCACACCACCACGCCTGG + Intergenic
1025127873 7:56359199-56359221 CAGGTGCACACCGTCACGCCTGG + Intergenic
1025194294 7:56920560-56920582 CAGGTGCACACCACCACGCCTGG + Intergenic
1025200976 7:56961514-56961536 CAGGTGCACACCACCACGCCTGG + Intergenic
1025245861 7:57316733-57316755 CAGGTACACACCACCACGCCTGG - Intergenic
1025670967 7:63615418-63615440 CAGGTGCACACCACCACGCCTGG - Intergenic
1025677657 7:63656385-63656407 CAGGTGCACACCACCACGCCTGG - Intergenic
1025997040 7:66534480-66534502 CCGGTGCACACCACCACGTCTGG - Intergenic
1026130402 7:67615909-67615931 CAGGTACACACCACCACGCCCGG - Intergenic
1026156457 7:67830170-67830192 CAGGTGCACACCACCACGCCCGG - Intergenic
1026239651 7:68561814-68561836 CAGATGCACACCACCACGCCTGG + Intergenic
1026699789 7:72630134-72630156 CAGGTGCACGCCGCCACGCCTGG - Intronic
1026884430 7:73930468-73930490 CAGGTGCACACTGCCACGCCTGG - Intergenic
1027126612 7:75560870-75560892 CAGGTGCACACCACCACGCCTGG + Intronic
1027166997 7:75841804-75841826 CAGGCTCACACCACCACGCCTGG - Intergenic
1027174664 7:75895678-75895700 CAGGTGCACACCACCACGCCCGG + Intergenic
1027186386 7:75973454-75973476 CAGGTGCACACCACCACGCCTGG + Intronic
1027203539 7:76079209-76079231 CAGGTGCCCACCGCCACGCCTGG + Intergenic
1027853106 7:83473948-83473970 CAGGTGCACACCACCACGCCTGG - Intronic
1028104047 7:86856301-86856323 CAGCTGCACACCACCATGCCTGG - Intronic
1028540175 7:91934418-91934440 CAGGTGCACACCACCACGCCTGG - Intergenic
1029194796 7:98797735-98797757 CAGGTGCACACCACCACGCCTGG + Intergenic
1029330526 7:99850097-99850119 CAGGTACACACCACCACGCCTGG + Intronic
1029348418 7:99995548-99995570 CAGGTGCACACCACCACGCCCGG + Intergenic
1029428837 7:100516026-100516048 CAGGTGCACACCACCACGCCTGG + Intergenic
1029467333 7:100734474-100734496 CAGGTGCACACCACCACGCCTGG - Intronic
1029577405 7:101412500-101412522 CAGGTGCACACCACCACGCCTGG - Intronic
1029645362 7:101851969-101851991 CAGGTGCACACCACCACGCCTGG + Intronic
1029741786 7:102495237-102495259 CCGCTGCACCCCGCAACCCCCGG + Intronic
1029759777 7:102594406-102594428 CCGCTGCACCCCGCAACCCCCGG + Intronic
1029777139 7:102690316-102690338 CCGCTGCACCCCGCAACCCCCGG + Intergenic
1029805878 7:102995642-102995664 CAGGTGCACACCACCACGCCTGG - Intronic
1029838531 7:103338437-103338459 CAGGTGCACACCACCACGCCTGG + Intronic
1030218764 7:107075243-107075265 CAGCTGCACACCACCATGCCTGG + Intronic
1030635734 7:111946722-111946744 CAGGTGCACACCACCACGCCTGG + Intronic
1031333486 7:120496565-120496587 CAGGTTCCCACCACCACGCCTGG + Intronic
1031339264 7:120578721-120578743 CAGGTGCACACCACCACGCCAGG - Intronic
1031765918 7:125777614-125777636 CAGGTGCACACCGCCACGCCTGG + Intergenic
1032141728 7:129337540-129337562 CAGGTGCACACCACCACGCCTGG + Intronic
1032208744 7:129892392-129892414 CAGGTGCACACCACCACGCCCGG + Intronic
1032655000 7:133918123-133918145 CCGGTGCCCACCACCACGCCCGG + Intronic
1032813795 7:135450494-135450516 CAGGTGCACACCACCACGCCTGG + Intronic
1033174337 7:139110674-139110696 CGGCTGCACACCACCATGCCCGG - Intergenic
1033195783 7:139326111-139326133 CAGGTACACACCACCACGCCTGG - Intergenic
1033229847 7:139588173-139588195 CAGGTGCACACCACCACGCCTGG - Intronic
1033739584 7:144259964-144259986 CAGGTACACGCCGCCACGCCGGG - Intergenic
1034640877 7:152601485-152601507 CCACTTCTCCCCCCCACGCCGGG + Intergenic
1034828032 7:154284710-154284732 CAGGTGCACACCACCACGCCCGG - Intronic
1034866224 7:154644849-154644871 CAGGTGCACACCGCCATGCCTGG + Intronic
1035000168 7:155606311-155606333 CAGGTGCACACCACCACGCCTGG + Intergenic
1035002335 7:155622910-155622932 CAGGTGCACACCGCCACACCTGG + Intronic
1035203622 7:157281159-157281181 CAGGTGCACACCACCACGCCCGG - Intergenic
1035232642 7:157475550-157475572 CAGGTGCACACTGCCACGCCCGG + Intergenic
1035431196 7:158823467-158823489 CAGGCGCACACCGCCACGCCCGG + Intronic
1035503695 8:109597-109619 CAGGTACACACCACCACGCCTGG + Intergenic
1035873919 8:3166389-3166411 CAGGTGCACACCACCACGCCCGG - Intronic
1035931952 8:3789872-3789894 CAGCTGCCCACCACCACGCCTGG + Intronic
1036002696 8:4625864-4625886 CAGGTACACACCCCCACGCCTGG + Intronic
1036556921 8:9868294-9868316 CAGGTGCACACCACCACGCCTGG + Intergenic
1036675573 8:10829141-10829163 CAGGTGCACACCACCACGCCTGG - Intronic
1036708657 8:11063353-11063375 CAGGTTCACACCACCACACCTGG - Intronic
1036959884 8:13232474-13232496 CAGGTTCACACCACCATGCCTGG + Intronic
1037006696 8:13790205-13790227 CAGATGCACACCACCACGCCTGG - Intergenic
1037018394 8:13937129-13937151 CAGGTGCACACCACCACGCCTGG - Intergenic
1037333270 8:17765475-17765497 CAGGTGCACACCACCACGCCTGG - Intronic
1037356869 8:18030137-18030159 CAGGTGCACACCACCACGCCCGG - Intergenic
1037524558 8:19712166-19712188 CAGGTTCGCGCCGCCACGCCCGG + Intronic
1037575199 8:20196590-20196612 CAGGTGCCCACCGCCACGCCCGG - Intergenic
1037886818 8:22599808-22599830 CCGCTTCCCGCCCCCAAGCCGGG + Intronic
1038306075 8:26403677-26403699 CAGGCTCACACTGCCACGCCTGG + Intronic
1038791255 8:30670350-30670372 CAGGTGCACACCACCACGCCCGG + Intergenic
1038898399 8:31813668-31813690 CAGGTGCACACCACCACGCCTGG + Intronic
1038945505 8:32355314-32355336 CAGGTGCACACCACCACGCCCGG - Intronic
1039017523 8:33168625-33168647 CAGGTGCACACCACCACGCCCGG - Intergenic
1039124980 8:34191453-34191475 CAGGTGCACACCACCACGCCTGG - Intergenic
1039421256 8:37443087-37443109 CAGGTGCACACCACCACGCCAGG - Intergenic
1039534440 8:38295417-38295439 CAGGTTCACACCACCACCCCTGG - Intronic
1039838326 8:41275643-41275665 CAGGCACACACCGCCACGCCCGG + Intronic
1042225087 8:66508850-66508872 CAGGTGCACACCACCACGCCCGG - Intronic
1042301304 8:67285372-67285394 CAGTTACACACCACCACGCCCGG - Intronic
1042318464 8:67449956-67449978 CAGGTGCACACCACCACGCCCGG + Intronic
1043012228 8:74895087-74895109 CAGATGCACACCACCACGCCTGG - Intergenic
1044143195 8:88680140-88680162 CAGGTGCACACCACCACGCCTGG + Intergenic
1044155431 8:88840324-88840346 CAGGTGCACACCACCACGCCAGG + Intergenic
1044681755 8:94786267-94786289 CAGGTGCACACCACCACGCCTGG + Intronic
1044995332 8:97832847-97832869 CAGGTGCGCACCGCCACGCCTGG + Intronic
1045102074 8:98854912-98854934 CAGGTGCACACCACCACGCCTGG - Intronic
1045519735 8:102893461-102893483 CAGGTGCACACTGCCACGCCTGG - Intronic
1045522555 8:102915887-102915909 CAGGTGCACACTGCCACGCCTGG + Intronic
1045742190 8:105374526-105374548 CAGGTGCACACCGCCACACCCGG + Intronic
1045866105 8:106867268-106867290 CAGGTGCACACCGCTACGCCCGG + Intergenic
1046101207 8:109616152-109616174 CAGGTACACACCACCACGCCTGG + Intronic
1046741550 8:117834460-117834482 CAGGTGCACACCACCACGCCTGG - Intronic
1046868209 8:119174557-119174579 CGGGTGCACACCACCACGCCTGG + Intronic
1046929197 8:119825825-119825847 CAGGTGCCCACCGCCACGCCTGG + Intronic
1047288081 8:123505591-123505613 CAGGTGCACACCGCCATGCCTGG - Intronic
1047997817 8:130353725-130353747 CAGGTGCACACCGCCATGCCTGG - Intronic
1048186601 8:132247653-132247675 CAGGCTCCCACCGCCACGCCCGG - Intronic
1049029594 8:140024538-140024560 CAGGTGCACACCACCACGCCTGG + Intronic
1049573723 8:143381147-143381169 CCGCTTCTGACCTCCAGGCCTGG - Intronic
1049935064 9:493688-493710 CAGCTACACACCACCACGCCTGG + Intronic
1050884252 9:10743744-10743766 CCGGCGCCCACCGCCACGCCCGG - Intergenic
1051292022 9:15554160-15554182 CCGGCGCACGCCGCCACGCCCGG + Intronic
1052116756 9:24657957-24657979 CAGGTGCACACCACCACGCCTGG - Intergenic
1052386284 9:27827247-27827269 CAGGTTCACACCACCACGCCTGG + Intergenic
1052896231 9:33750599-33750621 CCGCTCCACTCTGCCAGGCCTGG - Exonic
1053070346 9:35097465-35097487 CAGGTACACATCGCCACGCCTGG - Intergenic
1053156116 9:35780747-35780769 CAGATGCACACCACCACGCCTGG - Intergenic
1053178527 9:35947407-35947429 CAGGTGCACACCGCCACGCCTGG - Intergenic
1053408256 9:37896651-37896673 CAGGTGCACACCACCACGCCTGG - Intronic
1053660287 9:40270162-40270184 CAGGTGCACACCACCACGCCTGG - Intronic
1053910659 9:42899511-42899533 CAGGTGCACACCACCACGCCTGG - Intergenic
1054372417 9:64416458-64416480 CAGGTGCACACCACCACGCCTGG - Intergenic
1054524313 9:66106062-66106084 CAGGTGCACACCACCACGCCTGG + Intergenic
1054680035 9:67906156-67906178 CAGGTGCACACCACCACGCCTGG - Intergenic
1054741260 9:68808053-68808075 CAGATGCACACCACCACGCCAGG - Intronic
1055095891 9:72413945-72413967 CAGGTGCACACCGCCACGCCCGG + Intergenic
1055127746 9:72738558-72738580 CAGGTACACACCACCACGCCTGG + Intronic
1055342253 9:75296369-75296391 CAGGTGCACACCACCACGCCAGG - Intergenic
1055405630 9:75970762-75970784 CCGGCGCACACTGCCACGCCTGG + Intronic
1055516565 9:77039779-77039801 CAGGTGCACACCACCACGCCTGG - Intergenic
1055633583 9:78250594-78250616 CAGGTGCACGCCGCCACGCCCGG - Intronic
1056174310 9:84019343-84019365 CAGGTGCACACCACCACGCCTGG + Intergenic
1056319159 9:85420325-85420347 CAGGTGCACACTGCCACGCCTGG - Intergenic
1056362977 9:85877599-85877621 CAGGTGCACACTGCCACGCCTGG + Intergenic
1056536047 9:87528727-87528749 CAGGTGCACACCGCCACACCCGG - Intronic
1056895407 9:90542790-90542812 CAGGTGCACACCACCACGCCTGG - Intergenic
1057014098 9:91635219-91635241 CAGGTGCACACCGCCATGCCCGG - Intronic
1057264028 9:93602393-93602415 CAGGCACACACCGCCACGCCTGG + Intronic
1057419536 9:94899605-94899627 CAGGTGCACACCGCCACGTCTGG - Intronic
1057735208 9:97652144-97652166 CAGGTGCACACCACCACGCCCGG + Intronic
1058041783 9:100310578-100310600 CAGGTGCACACCACCACGCCTGG + Intronic
1058838652 9:108883304-108883326 CAGGTGCACACCGCCATGCCTGG + Intronic
1058968828 9:110061679-110061701 CAGGTACACACCACCACGCCTGG + Intronic
1058996621 9:110305003-110305025 CAGGTGCACACCACCACGCCTGG - Intronic
1059110285 9:111551548-111551570 CTGGTGCACACTGCCACGCCTGG + Intronic
1059128122 9:111714155-111714177 CAGGTGCACACCACCACGCCTGG + Intronic
1059156539 9:111994157-111994179 CAGGCACACACCGCCACGCCTGG + Intergenic
1059187430 9:112287481-112287503 CCGGTGCACACCACCACGCCCGG + Intronic
1059200587 9:112411531-112411553 CAGGTGCACACCACCACGCCTGG - Intronic
1060507382 9:124208385-124208407 CAGGTGCACACCACCACGCCTGG + Intergenic
1060599060 9:124865960-124865982 CAGGTGCACACCACCACGCCTGG - Intronic
1060601866 9:124883588-124883610 CTGGTTCCCACCACCACGCCCGG + Intronic
1060649973 9:125317173-125317195 CAGGTGCACACCACCACGCCTGG - Intronic
1060677567 9:125529029-125529051 CAGGTGCACACCACCACGCCCGG - Intronic
1060715844 9:125928038-125928060 CAGGTACACACCGCCACGCCCGG - Intronic
1060960590 9:127678068-127678090 CAGGTGCACACCACCACGCCCGG + Intronic
1061166316 9:128924467-128924489 CAGGTGCACACCACCACGCCTGG - Intronic
1061229784 9:129308544-129308566 CAGGTGCACACCACCACGCCTGG - Intergenic
1061259216 9:129470411-129470433 CAGGTGCACACCGCCACACCTGG - Intergenic
1061298737 9:129692086-129692108 CAGGTACACACCACCACGCCTGG + Intronic
1061857561 9:133450604-133450626 CAGGTGCACACCACCACGCCAGG - Intronic
1061910573 9:133720283-133720305 CAGCTGCCCACCACCACGCCCGG - Intronic
1062226268 9:135453725-135453747 CAGGTGCACACCACCACGCCCGG + Intergenic
1062507281 9:136884415-136884437 CCGGCGCACACCGCTACGCCCGG - Intronic
1062610409 9:137370998-137371020 CCACTGCTCACCGCCGCGCCCGG - Intronic
1203604618 Un_KI270748v1:47801-47823 CAGGTACACACCACCACGCCTGG - Intergenic
1185509592 X:653096-653118 CAGATACACACCACCACGCCCGG - Intronic
1185528679 X:799760-799782 CAGGTGCACACCACCACGCCTGG + Intergenic
1185599169 X:1327245-1327267 CAGGTGCACACCACCACGCCCGG - Intergenic
1185604880 X:1362916-1362938 CAGGTGCACACCACCACGCCTGG + Intronic
1185691747 X:2160748-2160770 CAGGTGCACACCACCACGCCTGG - Intergenic
1185994144 X:4925499-4925521 CAGGTGCACACCTCCACGCCGGG + Intergenic
1186267451 X:7847655-7847677 CAGGTGCACACCACCACGCCTGG - Intergenic
1186667353 X:11731307-11731329 CAGGTGCACACCACCACGCCCGG - Intergenic
1186769454 X:12803428-12803450 CAGGTGCACACCACCACGCCTGG + Intronic
1187074532 X:15921070-15921092 CAGGTGCACACCGCCATGCCCGG + Intergenic
1187074717 X:15922432-15922454 CAGGTGCACACCGCCATGCCCGG - Intergenic
1187418774 X:19116366-19116388 CAGTTTCACACCTCCATGCCTGG - Intronic
1187442719 X:19334593-19334615 CAGGTGCACACCACCACGCCTGG + Intergenic
1187732285 X:22267952-22267974 CAGGTGCACACCACCACGCCCGG - Intergenic
1187886441 X:23893287-23893309 CAGGTTCCCACCACCACGCCTGG - Intronic
1187902854 X:24040816-24040838 CAGGCGCACACCGCCACGCCCGG + Intergenic
1187906467 X:24071331-24071353 CAGGTGCACGCCGCCACGCCTGG + Intronic
1188917146 X:35925797-35925819 CAGCTGCACACCACCACGCCCGG + Intronic
1189318950 X:40075614-40075636 CAGGTGCACACCGCCACACCTGG - Intronic
1189328103 X:40125374-40125396 CAGGTGCACACCACCACGCCTGG + Intronic
1189341273 X:40206382-40206404 CAGGTACACACCACCACGCCGGG - Intergenic
1189381227 X:40503823-40503845 CAGGTGCACACCACCACGCCTGG + Intergenic
1189689707 X:43603165-43603187 CAGGTTCACACCACCACACCTGG - Intergenic
1189696481 X:43669273-43669295 CAGGTGCACACCACCACGCCAGG - Intronic
1189710697 X:43808845-43808867 CAGGTGCACACCACCACGCCTGG + Intronic
1189749999 X:44211383-44211405 CAGGTGCACACCACCACGCCTGG - Intronic
1189814109 X:44807530-44807552 CAGGTGCACACCACCACGCCTGG + Intergenic
1189815961 X:44824268-44824290 CAGGTGCACACCACCACGCCTGG + Intergenic
1190165169 X:48067782-48067804 CAGCTGTGCACCGCCACGCCAGG - Intronic
1190195518 X:48314627-48314649 CCGTTGCACACCACCACACCGGG - Intergenic
1190419600 X:50216089-50216111 CAGGTGCACACCACCACGCCTGG + Intronic
1190699160 X:52973803-52973825 CAGGTGCACGCCGCCACGCCTGG + Intronic
1190802649 X:53806142-53806164 CAGGTGCACACCACCACGCCTGG - Intergenic
1190871130 X:54425623-54425645 CAGGTGCACACCGCCACGCTAGG + Intergenic
1191997780 X:67114983-67115005 CAGGTTCCCACCACCACGCCTGG + Intergenic
1192325297 X:70126973-70126995 CAGGTACACACCACCACGCCTGG + Intergenic
1192464326 X:71343071-71343093 CCGGTGCCCACCACCACGCCTGG - Intergenic
1192481075 X:71486495-71486517 CAGGTGCACACCACCACGCCTGG + Intronic
1192893127 X:75411353-75411375 CAGGTGCCCACCGCCACGCCCGG + Intronic
1193125177 X:77863370-77863392 CAGGTGCACACCACCACGCCCGG - Intronic
1193916175 X:87366980-87367002 CAGGTGCACACCACCACGCCTGG - Intergenic
1194590329 X:95792464-95792486 CAGGTGCACACCACCACGCCTGG - Intergenic
1194758006 X:97760456-97760478 CAGGTGTACACCGCCACGCCCGG - Intergenic
1195371481 X:104178985-104179007 CAGGTGCACACCACCACGCCTGG - Intronic
1195484413 X:105387375-105387397 CAGGTGCACACCACCACGCCCGG + Intronic
1196111150 X:111948587-111948609 GAGGTGCACACCGCCACGCCTGG - Intronic
1196200497 X:112881198-112881220 CAGGTGCACACCACCACGCCCGG + Intergenic
1196435560 X:115671346-115671368 CAGGTGCACACCACCACGCCTGG - Intergenic
1196636354 X:118007264-118007286 CGGGTGCACACCACCACGCCTGG - Intronic
1196709102 X:118744001-118744023 CAGGTGCACACCACCACGCCTGG - Intronic
1197732346 X:129821777-129821799 CAGGTGCACACCACCACGCCCGG - Intronic
1197744691 X:129924097-129924119 CAGATCCACACCGCCATGCCTGG + Intronic
1197801682 X:130356369-130356391 CAGGTGCACACCACCACGCCTGG + Intronic
1197957517 X:131968274-131968296 CAGGTGCACACCGCCACACCCGG + Intergenic
1198382701 X:136099354-136099376 CAGGTGCACACCACCACGCCTGG + Intergenic
1198461897 X:136871296-136871318 CAGGTGCACACTGCCACGCCCGG - Intronic
1198550919 X:137744019-137744041 CAGTCACACACCGCCACGCCCGG + Intergenic
1198757645 X:139997689-139997711 CAGGTGCACACCACCACGCCTGG + Intergenic
1200303479 X:155001767-155001789 CAGGTGCACACCACCACGCCTGG - Intronic
1200797324 Y:7352896-7352918 CAGGTTCACACCACCATGCCAGG - Intergenic
1201303982 Y:12534999-12535021 CCGGTGCACACCACCACGCCTGG + Intergenic