ID: 1005456188

View in Genome Browser
Species Human (GRCh38)
Location 6:26021795-26021817
Sequence TCCGCTTCACACCGCCACGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 49}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005456188_1005456195 28 Left 1005456188 6:26021795-26021817 CCGGCGTGGCGGTGTGAAGCGGA 0: 1
1: 0
2: 0
3: 2
4: 49
Right 1005456195 6:26021846-26021868 CGGGGTGCTCAAGGTGTTTTTGG 0: 1
1: 0
2: 0
3: 5
4: 81
1005456188_1005456191 8 Left 1005456188 6:26021795-26021817 CCGGCGTGGCGGTGTGAAGCGGA 0: 1
1: 0
2: 0
3: 2
4: 49
Right 1005456191 6:26021826-26021848 CTGATCTACGAGGAGACTCGCGG 0: 1
1: 3
2: 3
3: 9
4: 31
1005456188_1005456192 9 Left 1005456188 6:26021795-26021817 CCGGCGTGGCGGTGTGAAGCGGA 0: 1
1: 0
2: 0
3: 2
4: 49
Right 1005456192 6:26021827-26021849 TGATCTACGAGGAGACTCGCGGG 0: 1
1: 3
2: 0
3: 1
4: 30
1005456188_1005456190 -2 Left 1005456188 6:26021795-26021817 CCGGCGTGGCGGTGTGAAGCGGA 0: 1
1: 0
2: 0
3: 2
4: 49
Right 1005456190 6:26021816-26021838 GATCTCTGGTCTGATCTACGAGG 0: 1
1: 0
2: 0
3: 6
4: 37
1005456188_1005456194 19 Left 1005456188 6:26021795-26021817 CCGGCGTGGCGGTGTGAAGCGGA 0: 1
1: 0
2: 0
3: 2
4: 49
Right 1005456194 6:26021837-26021859 GGAGACTCGCGGGGTGCTCAAGG 0: 1
1: 2
2: 2
3: 7
4: 89
1005456188_1005456193 10 Left 1005456188 6:26021795-26021817 CCGGCGTGGCGGTGTGAAGCGGA 0: 1
1: 0
2: 0
3: 2
4: 49
Right 1005456193 6:26021828-26021850 GATCTACGAGGAGACTCGCGGGG 0: 1
1: 3
2: 0
3: 0
4: 11

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005456188 Original CRISPR TCCGCTTCACACCGCCACGC CGG (reversed) Exonic
900817123 1:4856892-4856914 CCTGCTTCACACAGCCATGCAGG - Intergenic
901634422 1:10663924-10663946 TCCCCTCCACACCCCCACCCAGG - Intronic
903140136 1:21334456-21334478 TGCTGTTCACACGGCCACGCTGG - Intronic
912961047 1:114196300-114196322 TCCCCGTCACACAGTCACGCAGG + Intergenic
918248864 1:182684351-182684373 TGCGCTGCCCACCGCCAGGCAGG - Intronic
921486684 1:215723328-215723350 TACGCTTCTCACCCCCACGGAGG + Intronic
922762161 1:228140045-228140067 GCTGCGTCACAGCGCCACGCCGG - Intronic
1062915968 10:1241522-1241544 TCCGCGACACACCCCCAGGCTGG - Intronic
1075654716 10:124153278-124153300 GCAGCTTCACACAGCCAGGCGGG + Intergenic
1076658030 10:132037147-132037169 TCAGCATCCCACGGCCACGCTGG - Intergenic
1077112402 11:867700-867722 TCTGCTTCACCCCCCCACCCCGG + Intergenic
1077391143 11:2301167-2301189 CCCTCTTCCCACAGCCACGCTGG + Intronic
1083723436 11:64615176-64615198 TCCACTTCACAACTCCATGCCGG + Intronic
1090324551 11:125873816-125873838 GCCGCTTCCCACCGCAACCCGGG + Intergenic
1092973417 12:13720729-13720751 TCTGCCTCACACCTCCACTCAGG - Intronic
1121514803 14:94542522-94542544 TCCGTGTCGCACCACCACGCCGG - Intergenic
1121758660 14:96424210-96424232 TCCGCTCGGCCCCGCCACGCGGG - Intronic
1122529460 14:102415635-102415657 TCTGCTTCCCACCCCCACGTTGG - Intronic
1127647669 15:60974431-60974453 TCCCCTTCACACAGCCAGCCAGG + Intronic
1127996821 15:64157907-64157929 TCCACCTCTCACCCCCACGCTGG + Intronic
1138417676 16:56880445-56880467 TCCCCTTCCCACCTCCAGGCAGG + Intronic
1139215198 16:65120862-65120884 TCCGCTTCACAGCGTGAGGCGGG + Intronic
1159779618 18:72645950-72645972 TCTGCTGCACACCGTCACCCAGG + Intergenic
1163290032 19:16373251-16373273 TCCTCCTCACTCAGCCACGCTGG + Intronic
1165242937 19:34481916-34481938 TCCGCTTCCCGCCGCCGCTCCGG - Exonic
926755225 2:16229070-16229092 TCCGCCTCACCCCACCAAGCTGG + Intergenic
927645000 2:24872029-24872051 TCAGCCTCACACCCCCACTCAGG - Intronic
930716265 2:54596534-54596556 TCAGGTTCACACCCCCACGTTGG - Intronic
961666664 3:128497146-128497168 TCCGCTGCACTCGGACACGCGGG - Intergenic
967648267 3:191952844-191952866 TCCGCTTCGCGCCGCTACGTGGG - Intergenic
967852681 3:194093950-194093972 CCTGCCTCACACTGCCACGCAGG - Intergenic
970195486 4:13547212-13547234 TTCGCCACACACCGCCACTCTGG - Intergenic
972630477 4:40837420-40837442 GGCGCCTCACACAGCCACGCAGG + Intronic
1000809201 5:165839668-165839690 TCCCCTTCACACCCCCACCCTGG + Intergenic
1005456188 6:26021795-26021817 TCCGCTTCACACCGCCACGCCGG - Exonic
1005480014 6:26246839-26246861 TGCGCTTGACACCGCCATGCCGG + Exonic
1007990462 6:46249834-46249856 TCTGCTTCATACAGCCACTCAGG - Intronic
1023663348 7:42493616-42493638 TCCGAATAACACCGCCGCGCTGG - Intergenic
1028429963 7:90735698-90735720 TCGACTTCACACTGCTACGCTGG + Intronic
1034714053 7:153222910-153222932 ACCGCTCCACACCGCCACAACGG + Intergenic
1034917101 7:155049412-155049434 ACTGCTTCACACCGCCATGGGGG + Intergenic
1035009948 7:155706348-155706370 ACAGGTGCACACCGCCACGCCGG - Intronic
1041660822 8:60399332-60399354 TCTGCTTAACACCACAACGCTGG - Intergenic
1045273100 8:100678651-100678673 TCGGCTGCTCACCGCCACTCGGG - Intergenic
1048658956 8:136574582-136574604 ACCTCTTCACACCTCCACACTGG + Intergenic
1056786544 9:89596733-89596755 TCGGCTCCACACAGCCATGCAGG + Intergenic
1061989969 9:134153538-134153560 ACCACGTCACACCGCCAGGCAGG - Intronic
1189974401 X:46447238-46447260 TCCGCTTCCCACCGCCCCCTGGG - Exonic
1190264303 X:48818194-48818216 TCCGCTTCCCACCCCCTCCCTGG + Intronic
1190873084 X:54440809-54440831 TCCTCTCCACACCCCCACACAGG - Intronic
1191184008 X:57591467-57591489 TCCCCTTCCCACCTCCCCGCGGG - Intergenic
1200250569 X:154551658-154551680 TCCCCTACACACCTCCAAGCAGG - Intronic