ID: 1005456192

View in Genome Browser
Species Human (GRCh38)
Location 6:26021827-26021849
Sequence TGATCTACGAGGAGACTCGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 35
Summary {0: 1, 1: 3, 2: 0, 3: 1, 4: 30}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005456184_1005456192 21 Left 1005456184 6:26021783-26021805 CCGGCGTCTGGCCCGGCGTGGCG 0: 1
1: 0
2: 0
3: 11
4: 167
Right 1005456192 6:26021827-26021849 TGATCTACGAGGAGACTCGCGGG 0: 1
1: 3
2: 0
3: 1
4: 30
1005456186_1005456192 10 Left 1005456186 6:26021794-26021816 CCCGGCGTGGCGGTGTGAAGCGG 0: 1
1: 0
2: 0
3: 55
4: 1296
Right 1005456192 6:26021827-26021849 TGATCTACGAGGAGACTCGCGGG 0: 1
1: 3
2: 0
3: 1
4: 30
1005456180_1005456192 29 Left 1005456180 6:26021775-26021797 CCGGCCATCCGGCGTCTGGCCCG 0: 1
1: 0
2: 0
3: 10
4: 69
Right 1005456192 6:26021827-26021849 TGATCTACGAGGAGACTCGCGGG 0: 1
1: 3
2: 0
3: 1
4: 30
1005456188_1005456192 9 Left 1005456188 6:26021795-26021817 CCGGCGTGGCGGTGTGAAGCGGA 0: 1
1: 0
2: 0
3: 2
4: 49
Right 1005456192 6:26021827-26021849 TGATCTACGAGGAGACTCGCGGG 0: 1
1: 3
2: 0
3: 1
4: 30
1005456182_1005456192 25 Left 1005456182 6:26021779-26021801 CCATCCGGCGTCTGGCCCGGCGT 0: 1
1: 0
2: 0
3: 5
4: 56
Right 1005456192 6:26021827-26021849 TGATCTACGAGGAGACTCGCGGG 0: 1
1: 3
2: 0
3: 1
4: 30

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005456192 Original CRISPR TGATCTACGAGGAGACTCGC GGG Exonic
907801699 1:57772535-57772557 GCATCTAGGAGTAGACTCGCTGG + Intronic
921300372 1:213745934-213745956 TGATCTACGAGGACCCACTCTGG + Intergenic
1069068924 10:63974426-63974448 TGATGTTGGAGGAGACTAGCAGG + Intergenic
1069799233 10:71071983-71072005 TGATCTGGGAGGAGAGTGGCTGG + Intergenic
1070499237 10:77054878-77054900 TGTTCTACCAGGAGACGCACAGG + Intronic
1076782843 10:132733956-132733978 GGAGCTCCCAGGAGACTCGCAGG - Intronic
1100199194 12:92280287-92280309 TGATCTACAATCAGACTCTCTGG + Intergenic
1101422893 12:104564012-104564034 AGATCTACGTGGAGACACCCAGG + Intronic
1118997510 14:70850102-70850124 TGAGCAAGGAGGAGACTCGGAGG + Intergenic
1143130382 17:4673619-4673641 TCATCAAGGAGGAGACTCACAGG - Exonic
1152315029 17:79575160-79575182 TGATCTAAGAGGAAAGGCGCTGG + Intergenic
1167588324 19:50387711-50387733 TGATCTGCGAGGAGAGACCCGGG - Intronic
925396367 2:3536416-3536438 TGGTCCACGAGGGGACTCGGAGG - Intronic
927116154 2:19903818-19903840 TGATCTAAGAGGAAAATAGCAGG + Intergenic
1173849918 20:46211315-46211337 TGACCTTCCAGGAGACTCACAGG + Intronic
1175568278 20:59998279-59998301 TGAGCTTGGAGGAGACTGGCAGG + Intronic
961188780 3:124939823-124939845 TGATTTAGGAGGAGACTGGGGGG + Intronic
969129044 4:4977556-4977578 TGATTCACCAGGAGACTCACAGG - Intergenic
977868324 4:102058164-102058186 TTATTTACTAGGAGACTGGCTGG - Intronic
987577243 5:19745635-19745657 TGATCTCCAAGGAGAGTCGAGGG - Intronic
995524134 5:113037323-113037345 TGAACTCTGAGGAGTCTCGCTGG + Intronic
1005456192 6:26021827-26021849 TGATCTACGAGGAGACTCGCGGG + Exonic
1005475622 6:26204793-26204815 TCATCTACGAGGAGACTCGCGGG + Exonic
1005480009 6:26246807-26246829 TCATTTATGAGGAGACCCGCCGG - Exonic
1005643999 6:27824273-27824295 TCATCTACGAGGAGACTCGCGGG + Exonic
1005645198 6:27831357-27831379 TCATCTACGAGGAGACTCGCGGG - Exonic
1019273663 7:164673-164695 GGATCTGAGAGGAGACTCGCTGG - Intergenic
1021740262 7:23679913-23679935 TAATTTACAAGAAGACTCGCCGG + Intergenic
1021814308 7:24432763-24432785 TAATTTACAAGAAGACTCGCGGG + Intergenic
1027696264 7:81414675-81414697 TGATCTAGCAGGAGCCTAGCAGG - Intergenic
1028609466 7:92693422-92693444 TGATCTAGAAGGTGACTCTCAGG + Intronic
1035745560 8:1960037-1960059 TGATCAACAAGGAGCCTGGCTGG + Intergenic
1043726295 8:83615162-83615184 TAAGCTACGAGGAGACATGCTGG - Intergenic
1047176365 8:122544707-122544729 TGATCTCCGAGGTTACTTGCAGG - Intergenic
1186761107 X:12722877-12722899 TGATCTGAGATGAGACTCACAGG - Exonic