ID: 1005456722

View in Genome Browser
Species Human (GRCh38)
Location 6:26027107-26027129
Sequence GGTGGGGTTAAGCGAATTTC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 50}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005456722_1005456723 -10 Left 1005456722 6:26027107-26027129 CCGGAAATTCGCTTAACCCCACC 0: 1
1: 0
2: 0
3: 7
4: 50
Right 1005456723 6:26027120-26027142 TAACCCCACCACGCCTAGCAAGG 0: 1
1: 0
2: 0
3: 3
4: 57
1005456722_1005456733 20 Left 1005456722 6:26027107-26027129 CCGGAAATTCGCTTAACCCCACC 0: 1
1: 0
2: 0
3: 7
4: 50
Right 1005456733 6:26027150-26027172 TGGCCGGTTTGGTGATGCCTTGG 0: 1
1: 0
2: 4
3: 2
4: 171
1005456722_1005456728 0 Left 1005456722 6:26027107-26027129 CCGGAAATTCGCTTAACCCCACC 0: 1
1: 0
2: 0
3: 7
4: 50
Right 1005456728 6:26027130-26027152 ACGCCTAGCAAGGCGCCGAATGG 0: 1
1: 0
2: 0
3: 3
4: 18
1005456722_1005456731 9 Left 1005456722 6:26027107-26027129 CCGGAAATTCGCTTAACCCCACC 0: 1
1: 0
2: 0
3: 7
4: 50
Right 1005456731 6:26027139-26027161 AAGGCGCCGAATGGCCGGTTTGG 0: 1
1: 0
2: 3
3: 2
4: 14
1005456722_1005456730 4 Left 1005456722 6:26027107-26027129 CCGGAAATTCGCTTAACCCCACC 0: 1
1: 0
2: 0
3: 7
4: 50
Right 1005456730 6:26027134-26027156 CTAGCAAGGCGCCGAATGGCCGG 0: 1
1: 1
2: 3
3: 5
4: 32

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005456722 Original CRISPR GGTGGGGTTAAGCGAATTTC CGG (reversed) Exonic
906651523 1:47516245-47516267 GGTGGAGATAAGCGAATTATGGG + Intergenic
908161078 1:61409161-61409183 GGTGGGGGTGAGAGAATATCAGG + Intronic
914665971 1:149832808-149832830 GGCGGCGTTAAGCGGATCTCTGG + Intergenic
914669794 1:149860986-149861008 GGCGGCGTTAAGCGGATCTCTGG - Exonic
916940672 1:169673821-169673843 GGTGGGGTTAAGCTACTTTGTGG + Intronic
920612688 1:207456831-207456853 AGTGGGGTACAGAGAATTTCAGG - Intronic
921322733 1:213958606-213958628 GGTGGTGTTCAGCAAATCTCAGG - Intergenic
1070277928 10:75025492-75025514 TTTGGGGATAAGCCAATTTCTGG - Intronic
1073453963 10:103625507-103625529 GGTGGGGGCAAGGGCATTTCAGG + Intronic
1084575355 11:69985351-69985373 GGTGGGCAGAGGCGAATTTCTGG + Intergenic
1093077269 12:14770939-14770961 GGGGGCGTCAAGCGCATTTCTGG - Exonic
1097042267 12:56162935-56162957 GGTGGGGAAAACCTAATTTCGGG - Intronic
1098383106 12:69890131-69890153 GGTTGATTTAAGAGAATTTCTGG + Intronic
1100091643 12:90979299-90979321 GGTGTGGTTAAGGGAAAGTCTGG - Intronic
1109304181 13:60620482-60620504 GGTGGGGCAAAGGGCATTTCAGG - Intergenic
1111026390 13:82532512-82532534 GGTGGGGTAATGAGAATTTGTGG - Intergenic
1111330960 13:86761709-86761731 AGTGGGGTTAAGGGAACTTTTGG + Intergenic
1136147912 16:28326631-28326653 GGTGGGGTGAAGCGAAGATGGGG - Intergenic
1155616189 18:27724335-27724357 GGTAGGGCTAAGGGAATTTGGGG - Intergenic
1158047095 18:53169514-53169536 GGTGGAGTTAAGCCAAATTCAGG - Intronic
925631550 2:5899004-5899026 GTTGGGGTTAAGAGAAGTTGGGG - Intergenic
929539304 2:42808216-42808238 GGTGAGGTTAAGTGCCTTTCAGG + Intergenic
933476721 2:82800882-82800904 TGTGGGATTCAGCTAATTTCAGG - Intergenic
936261385 2:110962355-110962377 GGTGGGGGGAAGTGAACTTCTGG + Intronic
938944263 2:136196979-136197001 GGTGGAGATAAGCGAATTATGGG - Intergenic
1169763658 20:9125066-9125088 GATGGAGTCAAGCGTATTTCAGG - Intronic
1174080579 20:47968504-47968526 GGTGGGGTTAAGCGGAGTGACGG - Intergenic
1174264817 20:49323675-49323697 GGTGGGGTGAAGCGATTCTAAGG + Intergenic
1181509397 22:23382284-23382306 GTTGGGGTAAAAGGAATTTCAGG + Intergenic
1184720481 22:46309644-46309666 GGTGGGGGTAAAGGAATTTCTGG - Intronic
954278079 3:49555074-49555096 GTTGGGGAGAAGCGAATTTGGGG - Intronic
963222657 3:142828145-142828167 GATGGGTTTAAGCAAAGTTCAGG - Intronic
965496126 3:169401302-169401324 GGTGGGGGTGGGAGAATTTCAGG - Intronic
967844102 3:194030934-194030956 GGTGGGGTCAAGAGAAACTCTGG - Intergenic
969046181 4:4338497-4338519 GGTGGGGAGGAGCGAATGTCAGG + Intergenic
971739072 4:30497686-30497708 GGAGGGGGTAAGCAAAATTCTGG - Intergenic
972794494 4:42401376-42401398 GGAGGGGGTAAGCGAAATACTGG - Exonic
977427649 4:96889078-96889100 GGTGTGCTTAAGCAATTTTCTGG - Intergenic
981381060 4:144072178-144072200 GGTGGGATAAACCCAATTTCTGG + Intergenic
982676738 4:158384562-158384584 AGTGCAGTTAAGAGAATTTCTGG + Intronic
988431256 5:31121587-31121609 GATGGGTTTAAGTGAATTTATGG - Intergenic
990009985 5:50985809-50985831 GGTGGGGTTAAATAAATTTCAGG + Intergenic
1005456722 6:26027107-26027129 GGTGGGGTTAAGCGAATTTCCGG - Exonic
1005464977 6:26104071-26104093 GGTGGCGTCAAGCGCATTTCCGG + Exonic
1005473922 6:26188931-26188953 GGCGGCGTCAAGCGTATTTCTGG - Exonic
1005475619 6:26204768-26204790 GGGGGTGTCAAGCGCATTTCTGG + Exonic
1005484324 6:26285354-26285376 GGCGGTGTCAAGCGAATTTCTGG - Exonic
1005570361 6:27139432-27139454 GGCGGCGTGAAGCGCATTTCTGG + Exonic
1005649457 6:27873365-27873387 GGAGGCGTTAAGCGCATCTCAGG - Exonic
1015239741 6:131009150-131009172 GGTGGAGTTAAGTGAATCACAGG + Intronic
1020482372 7:8678264-8678286 GGTGGGGTTTATTGAACTTCTGG - Intronic
1040495063 8:47959353-47959375 GGTGGGATTAGGCGAGATTCAGG + Intronic
1046158081 8:110320213-110320235 GCTGGGTTAAAGAGAATTTCAGG + Intergenic
1050642966 9:7688236-7688258 TTTGGGATTAAGCGAACTTCAGG + Intergenic
1058219528 9:102279987-102280009 GGTGGGGTTAAATCAGTTTCTGG + Intergenic
1187111841 X:16310037-16310059 GAATGGGTTAAGGGAATTTCAGG + Intergenic
1197290324 X:124648468-124648490 GGTGTGGTTAAGTGAATGTCAGG - Intronic
1201984830 Y:19954384-19954406 GGTGGGATTAACCTAACTTCAGG + Intergenic