ID: 1005463006

View in Genome Browser
Species Human (GRCh38)
Location 6:26086905-26086927
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005463006_1005463009 15 Left 1005463006 6:26086905-26086927 CCAGATAATCCCAATACTGTAAA No data
Right 1005463009 6:26086943-26086965 GTCAGATAATTCAATTATGAAGG No data
1005463006_1005463011 25 Left 1005463006 6:26086905-26086927 CCAGATAATCCCAATACTGTAAA No data
Right 1005463011 6:26086953-26086975 TCAATTATGAAGGCTGTGGAAGG No data
1005463006_1005463010 21 Left 1005463006 6:26086905-26086927 CCAGATAATCCCAATACTGTAAA No data
Right 1005463010 6:26086949-26086971 TAATTCAATTATGAAGGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005463006 Original CRISPR TTTACAGTATTGGGATTATC TGG (reversed) Intergenic
No off target data available for this crispr