ID: 1005463007

View in Genome Browser
Species Human (GRCh38)
Location 6:26086914-26086936
Sequence TTCACAAACTTTACAGTATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005463007_1005463011 16 Left 1005463007 6:26086914-26086936 CCCAATACTGTAAAGTTTGTGAA No data
Right 1005463011 6:26086953-26086975 TCAATTATGAAGGCTGTGGAAGG No data
1005463007_1005463012 28 Left 1005463007 6:26086914-26086936 CCCAATACTGTAAAGTTTGTGAA No data
Right 1005463012 6:26086965-26086987 GCTGTGGAAGGTGTTTCAGTAGG No data
1005463007_1005463009 6 Left 1005463007 6:26086914-26086936 CCCAATACTGTAAAGTTTGTGAA No data
Right 1005463009 6:26086943-26086965 GTCAGATAATTCAATTATGAAGG No data
1005463007_1005463010 12 Left 1005463007 6:26086914-26086936 CCCAATACTGTAAAGTTTGTGAA No data
Right 1005463010 6:26086949-26086971 TAATTCAATTATGAAGGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005463007 Original CRISPR TTCACAAACTTTACAGTATT GGG (reversed) Intergenic
No off target data available for this crispr