ID: 1005463011

View in Genome Browser
Species Human (GRCh38)
Location 6:26086953-26086975
Sequence TCAATTATGAAGGCTGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005463008_1005463011 15 Left 1005463008 6:26086915-26086937 CCAATACTGTAAAGTTTGTGAAA No data
Right 1005463011 6:26086953-26086975 TCAATTATGAAGGCTGTGGAAGG No data
1005463007_1005463011 16 Left 1005463007 6:26086914-26086936 CCCAATACTGTAAAGTTTGTGAA No data
Right 1005463011 6:26086953-26086975 TCAATTATGAAGGCTGTGGAAGG No data
1005463006_1005463011 25 Left 1005463006 6:26086905-26086927 CCAGATAATCCCAATACTGTAAA No data
Right 1005463011 6:26086953-26086975 TCAATTATGAAGGCTGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005463011 Original CRISPR TCAATTATGAAGGCTGTGGA AGG Intergenic
No off target data available for this crispr