ID: 1005464945

View in Genome Browser
Species Human (GRCh38)
Location 6:26103887-26103909
Sequence GTCCGCCAAGTTTGTATTTA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 54}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005464941_1005464945 29 Left 1005464941 6:26103835-26103857 CCAAATTTGAAAAAAAAAAAAAA 0: 6
1: 92
2: 1251
3: 11973
4: 73434
Right 1005464945 6:26103887-26103909 GTCCGCCAAGTTTGTATTTAAGG 0: 1
1: 0
2: 1
3: 3
4: 54
1005464942_1005464945 6 Left 1005464942 6:26103858-26103880 CCGCGCCAACTCATGTTGTTTTC 0: 1
1: 0
2: 3
3: 84
4: 1069
Right 1005464945 6:26103887-26103909 GTCCGCCAAGTTTGTATTTAAGG 0: 1
1: 0
2: 1
3: 3
4: 54
1005464943_1005464945 1 Left 1005464943 6:26103863-26103885 CCAACTCATGTTGTTTTCAATCA 0: 1
1: 0
2: 1
3: 22
4: 239
Right 1005464945 6:26103887-26103909 GTCCGCCAAGTTTGTATTTAAGG 0: 1
1: 0
2: 1
3: 3
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005464945 Original CRISPR GTCCGCCAAGTTTGTATTTA AGG Exonic
902358426 1:15925894-15925916 ATCCTCAAAGTATGTATTTATGG + Intronic
902846851 1:19117655-19117677 CCCAGCCAAGTTTCTATTTAAGG + Intronic
908686609 1:66727237-66727259 GTCTGCCAAGTTTTTAAATAGGG - Intronic
909095481 1:71282082-71282104 GTTTGCCAATTTTGTTTTTAAGG + Intergenic
1069012131 10:63386220-63386242 GTCTGTGAAGTTTGTATTTAGGG - Intronic
1073660176 10:105466902-105466924 CTCCCCCAATTATGTATTTAGGG + Intergenic
1076118878 10:127920526-127920548 GTCCACCCAGATTGCATTTATGG + Intronic
1087801936 11:102513967-102513989 GTCAGCCAAGTTGGTATCTGAGG + Intergenic
1089884737 11:121809064-121809086 GTCCACAAATTTTGCATTTATGG - Intergenic
1101586130 12:106087635-106087657 GTGCACCAAGTTTGTGTGTAAGG + Intronic
1108467470 13:50731126-50731148 GTCGGCCAAGTCTTCATTTATGG + Intronic
1111381622 13:87461237-87461259 AAGCGCCAATTTTGTATTTAAGG - Intergenic
1113536570 13:111071331-111071353 GACCAGCAAGTTTTTATTTAGGG + Intergenic
1114255165 14:20995532-20995554 GTCCGCAAAGTTTCTTTTAAAGG - Intronic
1118439582 14:65800334-65800356 GTTCCCCAAGTTAGTATTAAGGG - Intergenic
1120652632 14:87152498-87152520 GTGTGCTAAGTTTGTCTTTATGG - Intergenic
1121510481 14:94509492-94509514 GTCCACCCAGTTTGTAGATAAGG - Intronic
1127595017 15:60472695-60472717 GTGTGCCAAGTTTATTTTTACGG - Intronic
1131314619 15:91323450-91323472 GTACATCAATTTTGTATTTATGG + Intergenic
1137989362 16:53137421-53137443 TTCTGTCAAGTTTGTATTTCTGG + Intronic
1140131886 16:72169911-72169933 GTGTGCCAATTTTGTTTTTATGG - Intronic
1142242224 16:88952806-88952828 GTCCGCCAAGTATTTGTTGAGGG - Intronic
1143313736 17:6015244-6015266 ATCCACCAAGGTTGAATTTAAGG + Intronic
1144814221 17:18022037-18022059 GTCCTCCAAGTTTGCTTTTGAGG - Intronic
1148123120 17:45223766-45223788 TTCCGCCAAGTGTGTGTCTATGG + Intronic
1149293799 17:55242314-55242336 GTTCTCCAAGTTTTTGTTTAGGG + Intergenic
1151246625 17:72799928-72799950 GACCGGCAAGTTTTTATTAAGGG - Intronic
1154966731 18:21365723-21365745 GTCTGTCAAGTCTGCATTTATGG - Intronic
926181612 2:10649479-10649501 CTCAGCTAAGTTTGTATTTTTGG + Intronic
934732180 2:96666305-96666327 GTCCTCCAAGTTCAGATTTATGG - Intergenic
936919936 2:117677475-117677497 CTCCTCCAAGCTTGTATTTCGGG - Intergenic
936989599 2:118348538-118348560 GTCAGCCAAGTTTGTGCTCAGGG - Intergenic
938774062 2:134525664-134525686 GACCTCCAAGTTTGTGTTTAGGG + Intronic
942496432 2:176544949-176544971 GTCAGCCAGTTTTATATTTAAGG + Intergenic
1173434492 20:43020528-43020550 GTCTGCCAACTTTTTAATTATGG - Intronic
1174931728 20:54823456-54823478 TTCAGGCAAGTATGTATTTAGGG - Intergenic
1178231448 21:30789675-30789697 GGCCCCCACGTTTGTCTTTATGG - Intergenic
952877168 3:37955866-37955888 CTCCGCCAAGTATGTCTGTAGGG + Intronic
955869942 3:63427060-63427082 GTCTTCCAAGTTTGAATTTTAGG - Intronic
968840090 4:2997187-2997209 TTCAGCCAAATTTGAATTTATGG + Intronic
970005614 4:11408072-11408094 GTCTGCTGAGTTTGTATTTTGGG + Intronic
971598097 4:28557409-28557431 GTGAGCCAAGTATGTATTTTAGG - Intergenic
972636497 4:40888878-40888900 GTCCTCCAAGTTTGTTTTTAAGG - Intronic
973024174 4:45246414-45246436 ATCCTCCAAGTTTATAATTATGG + Intergenic
975640149 4:76492151-76492173 TTTCGCCCAGTTTGTATCTAGGG - Intronic
980130851 4:128814270-128814292 GTCCTCCAAGTTTGTTTTTTAGG - Intronic
982286061 4:153736473-153736495 GTCCTCCAACTTTGTCTTTCTGG + Intronic
991101337 5:62796918-62796940 GACCGGCAAGTTTTTATTAAGGG + Intergenic
999912951 5:156225537-156225559 CTCCGACAATTTTGTCTTTAGGG + Intronic
1004618406 6:17312296-17312318 GTCCGCCCAGTTCTTCTTTATGG + Intergenic
1005464945 6:26103887-26103909 GTCCGCCAAGTTTGTATTTAAGG + Exonic
1021538403 7:21730323-21730345 GTCCTCCAAGTTTTTAATTTTGG - Intronic
1031212786 7:118852047-118852069 GGCCCTCAAGTTTGTATGTATGG + Intergenic
1038201487 8:25417022-25417044 ATCTGTCAAGTTAGTATTTACGG - Intronic
1042944839 8:74144616-74144638 GTACGCCAAGCTTTTATTGAGGG + Intergenic
1043162205 8:76859791-76859813 GTCCCTCAAGTTTATATTTGAGG - Intronic
1057006720 9:91567271-91567293 CTCGGCCAGGTTTTTATTTATGG + Intronic
1196068892 X:111497440-111497462 GTAGGCCAAGCTTATATTTAGGG - Intergenic
1201959546 Y:19663808-19663830 GTCTGCCAATTTTGTATTACTGG - Intergenic