ID: 1005468677

View in Genome Browser
Species Human (GRCh38)
Location 6:26140675-26140697
Sequence CAGATTAAGGATGAAGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005468671_1005468677 2 Left 1005468671 6:26140650-26140672 CCCATTTTCTTTAGCACAGTCCC No data
Right 1005468677 6:26140675-26140697 CAGATTAAGGATGAAGAGGCTGG No data
1005468672_1005468677 1 Left 1005468672 6:26140651-26140673 CCATTTTCTTTAGCACAGTCCCT No data
Right 1005468677 6:26140675-26140697 CAGATTAAGGATGAAGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005468677 Original CRISPR CAGATTAAGGATGAAGAGGC TGG Intergenic
No off target data available for this crispr