ID: 1005469072

View in Genome Browser
Species Human (GRCh38)
Location 6:26144035-26144057
Sequence ACTTTAGCCTCCAGAGAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005469072_1005469077 5 Left 1005469072 6:26144035-26144057 CCAGTTTCTCTGGAGGCTAAAGT No data
Right 1005469077 6:26144063-26144085 GATTACTTGAGCCCAAGGGGCGG No data
1005469072_1005469076 2 Left 1005469072 6:26144035-26144057 CCAGTTTCTCTGGAGGCTAAAGT No data
Right 1005469076 6:26144060-26144082 GAGGATTACTTGAGCCCAAGGGG 0: 22
1: 880
2: 9822
3: 25815
4: 82067
1005469072_1005469075 1 Left 1005469072 6:26144035-26144057 CCAGTTTCTCTGGAGGCTAAAGT No data
Right 1005469075 6:26144059-26144081 AGAGGATTACTTGAGCCCAAGGG No data
1005469072_1005469074 0 Left 1005469072 6:26144035-26144057 CCAGTTTCTCTGGAGGCTAAAGT No data
Right 1005469074 6:26144058-26144080 GAGAGGATTACTTGAGCCCAAGG No data
1005469072_1005469078 8 Left 1005469072 6:26144035-26144057 CCAGTTTCTCTGGAGGCTAAAGT No data
Right 1005469078 6:26144066-26144088 TACTTGAGCCCAAGGGGCGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005469072 Original CRISPR ACTTTAGCCTCCAGAGAAAC TGG (reversed) Intergenic
No off target data available for this crispr