ID: 1005470262 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:26156395-26156417 |
| Sequence | GGGCGCGGCAGGCGCAGTCT CGG (reversed) |
| Strand | - |
| Crispr in exon? | Yes |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 162 | |||
| Summary | {0: 1, 1: 0, 2: 2, 3: 9, 4: 150} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1005470262_1005470273 | 20 | Left | 1005470262 | 6:26156395-26156417 | CCGAGACTGCGCCTGCCGCGCCC | 0: 1 1: 0 2: 2 3: 9 4: 150 |
||
| Right | 1005470273 | 6:26156438-26156460 | GAAGACTCCCGTGAAGAAGAAGG | 0: 1 1: 0 2: 1 3: 15 4: 157 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1005470262 | Original CRISPR | GGGCGCGGCAGGCGCAGTCT CGG (reversed) | Exonic | ||