ID: 1005470265 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:26156410-26156432 |
| Sequence | AGGGGCCGGAGCAGCGGGCG CGG (reversed) |
| Strand | - |
| Crispr in exon? | Yes |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 681 | |||
| Summary | {0: 1, 1: 0, 2: 2, 3: 59, 4: 619} |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1005470265_1005470276 | 21 | Left | 1005470265 | 6:26156410-26156432 | CCGCGCCCGCTGCTCCGGCCCCT | 0: 1 1: 0 2: 2 3: 59 4: 619 |
||
| Right | 1005470276 | 6:26156454-26156476 | AAGAAGGCCCGCAAGTCTGCAGG | 0: 1 1: 0 2: 0 3: 4 4: 69 |
||||
| 1005470265_1005470273 | 5 | Left | 1005470265 | 6:26156410-26156432 | CCGCGCCCGCTGCTCCGGCCCCT | 0: 1 1: 0 2: 2 3: 59 4: 619 |
||
| Right | 1005470273 | 6:26156438-26156460 | GAAGACTCCCGTGAAGAAGAAGG | 0: 1 1: 0 2: 1 3: 15 4: 157 |
||||
| 1005470265_1005470277 | 26 | Left | 1005470265 | 6:26156410-26156432 | CCGCGCCCGCTGCTCCGGCCCCT | 0: 1 1: 0 2: 2 3: 59 4: 619 |
||
| Right | 1005470277 | 6:26156459-26156481 | GGCCCGCAAGTCTGCAGGTGCGG | 0: 1 1: 0 2: 0 3: 10 4: 125 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1005470265 | Original CRISPR | AGGGGCCGGAGCAGCGGGCG CGG (reversed) | Exonic | ||