ID: 1005470266

View in Genome Browser
Species Human (GRCh38)
Location 6:26156415-26156437
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 409
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 383}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005470266_1005470276 16 Left 1005470266 6:26156415-26156437 CCCGCTGCTCCGGCCCCTGCCGA 0: 1
1: 0
2: 2
3: 23
4: 383
Right 1005470276 6:26156454-26156476 AAGAAGGCCCGCAAGTCTGCAGG 0: 1
1: 0
2: 0
3: 4
4: 69
1005470266_1005470277 21 Left 1005470266 6:26156415-26156437 CCCGCTGCTCCGGCCCCTGCCGA 0: 1
1: 0
2: 2
3: 23
4: 383
Right 1005470277 6:26156459-26156481 GGCCCGCAAGTCTGCAGGTGCGG 0: 1
1: 0
2: 0
3: 10
4: 125
1005470266_1005470273 0 Left 1005470266 6:26156415-26156437 CCCGCTGCTCCGGCCCCTGCCGA 0: 1
1: 0
2: 2
3: 23
4: 383
Right 1005470273 6:26156438-26156460 GAAGACTCCCGTGAAGAAGAAGG 0: 1
1: 0
2: 1
3: 15
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005470266 Original CRISPR TCGGCAGGGGCCGGAGCAGC GGG (reversed) Exonic