ID: 1005470268

View in Genome Browser
Species Human (GRCh38)
Location 6:26156424-26156446
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 191}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005470268_1005470276 7 Left 1005470268 6:26156424-26156446 CCGGCCCCTGCCGAGAAGACTCC 0: 1
1: 0
2: 0
3: 16
4: 191
Right 1005470276 6:26156454-26156476 AAGAAGGCCCGCAAGTCTGCAGG 0: 1
1: 0
2: 0
3: 4
4: 69
1005470268_1005470273 -9 Left 1005470268 6:26156424-26156446 CCGGCCCCTGCCGAGAAGACTCC 0: 1
1: 0
2: 0
3: 16
4: 191
Right 1005470273 6:26156438-26156460 GAAGACTCCCGTGAAGAAGAAGG 0: 1
1: 0
2: 1
3: 15
4: 157
1005470268_1005470277 12 Left 1005470268 6:26156424-26156446 CCGGCCCCTGCCGAGAAGACTCC 0: 1
1: 0
2: 0
3: 16
4: 191
Right 1005470277 6:26156459-26156481 GGCCCGCAAGTCTGCAGGTGCGG 0: 1
1: 0
2: 0
3: 10
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005470268 Original CRISPR GGAGTCTTCTCGGCAGGGGC CGG (reversed) Exonic