ID: 1005470269

View in Genome Browser
Species Human (GRCh38)
Location 6:26156428-26156450
Sequence CACGGGAGTCTTCTCGGCAG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 104}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005470269_1005470280 27 Left 1005470269 6:26156428-26156450 CCCCTGCCGAGAAGACTCCCGTG 0: 1
1: 0
2: 0
3: 2
4: 104
Right 1005470280 6:26156478-26156500 GCGGCCAAGCGCAAAGCGTCTGG 0: 1
1: 0
2: 0
3: 4
4: 26
1005470269_1005470276 3 Left 1005470269 6:26156428-26156450 CCCCTGCCGAGAAGACTCCCGTG 0: 1
1: 0
2: 0
3: 2
4: 104
Right 1005470276 6:26156454-26156476 AAGAAGGCCCGCAAGTCTGCAGG 0: 1
1: 0
2: 0
3: 4
4: 69
1005470269_1005470277 8 Left 1005470269 6:26156428-26156450 CCCCTGCCGAGAAGACTCCCGTG 0: 1
1: 0
2: 0
3: 2
4: 104
Right 1005470277 6:26156459-26156481 GGCCCGCAAGTCTGCAGGTGCGG 0: 1
1: 0
2: 0
3: 10
4: 125
1005470269_1005470281 28 Left 1005470269 6:26156428-26156450 CCCCTGCCGAGAAGACTCCCGTG 0: 1
1: 0
2: 0
3: 2
4: 104
Right 1005470281 6:26156479-26156501 CGGCCAAGCGCAAAGCGTCTGGG 0: 1
1: 0
2: 0
3: 2
4: 17

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005470269 Original CRISPR CACGGGAGTCTTCTCGGCAG GGG (reversed) Exonic