ID: 1005470271

View in Genome Browser
Species Human (GRCh38)
Location 6:26156430-26156452
Sequence TTCACGGGAGTCTTCTCGGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 41
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 38}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005470271_1005470281 26 Left 1005470271 6:26156430-26156452 CCTGCCGAGAAGACTCCCGTGAA 0: 1
1: 0
2: 0
3: 2
4: 38
Right 1005470281 6:26156479-26156501 CGGCCAAGCGCAAAGCGTCTGGG 0: 1
1: 0
2: 0
3: 2
4: 17
1005470271_1005470280 25 Left 1005470271 6:26156430-26156452 CCTGCCGAGAAGACTCCCGTGAA 0: 1
1: 0
2: 0
3: 2
4: 38
Right 1005470280 6:26156478-26156500 GCGGCCAAGCGCAAAGCGTCTGG 0: 1
1: 0
2: 0
3: 4
4: 26
1005470271_1005470276 1 Left 1005470271 6:26156430-26156452 CCTGCCGAGAAGACTCCCGTGAA 0: 1
1: 0
2: 0
3: 2
4: 38
Right 1005470276 6:26156454-26156476 AAGAAGGCCCGCAAGTCTGCAGG 0: 1
1: 0
2: 0
3: 4
4: 69
1005470271_1005470277 6 Left 1005470271 6:26156430-26156452 CCTGCCGAGAAGACTCCCGTGAA 0: 1
1: 0
2: 0
3: 2
4: 38
Right 1005470277 6:26156459-26156481 GGCCCGCAAGTCTGCAGGTGCGG 0: 1
1: 0
2: 0
3: 10
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005470271 Original CRISPR TTCACGGGAGTCTTCTCGGC AGG (reversed) Exonic