ID: 1005470273

View in Genome Browser
Species Human (GRCh38)
Location 6:26156438-26156460
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 157}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005470262_1005470273 20 Left 1005470262 6:26156395-26156417 CCGAGACTGCGCCTGCCGCGCCC 0: 1
1: 0
2: 2
3: 9
4: 150
Right 1005470273 6:26156438-26156460 GAAGACTCCCGTGAAGAAGAAGG 0: 1
1: 0
2: 1
3: 15
4: 157
1005470264_1005470273 9 Left 1005470264 6:26156406-26156428 CCTGCCGCGCCCGCTGCTCCGGC 0: 1
1: 1
2: 5
3: 76
4: 524
Right 1005470273 6:26156438-26156460 GAAGACTCCCGTGAAGAAGAAGG 0: 1
1: 0
2: 1
3: 15
4: 157
1005470268_1005470273 -9 Left 1005470268 6:26156424-26156446 CCGGCCCCTGCCGAGAAGACTCC 0: 1
1: 0
2: 0
3: 16
4: 191
Right 1005470273 6:26156438-26156460 GAAGACTCCCGTGAAGAAGAAGG 0: 1
1: 0
2: 1
3: 15
4: 157
1005470266_1005470273 0 Left 1005470266 6:26156415-26156437 CCCGCTGCTCCGGCCCCTGCCGA 0: 1
1: 0
2: 2
3: 23
4: 383
Right 1005470273 6:26156438-26156460 GAAGACTCCCGTGAAGAAGAAGG 0: 1
1: 0
2: 1
3: 15
4: 157
1005470265_1005470273 5 Left 1005470265 6:26156410-26156432 CCGCGCCCGCTGCTCCGGCCCCT 0: 1
1: 0
2: 2
3: 59
4: 619
Right 1005470273 6:26156438-26156460 GAAGACTCCCGTGAAGAAGAAGG 0: 1
1: 0
2: 1
3: 15
4: 157
1005470267_1005470273 -1 Left 1005470267 6:26156416-26156438 CCGCTGCTCCGGCCCCTGCCGAG 0: 1
1: 0
2: 1
3: 39
4: 427
Right 1005470273 6:26156438-26156460 GAAGACTCCCGTGAAGAAGAAGG 0: 1
1: 0
2: 1
3: 15
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type