ID: 1005470277

View in Genome Browser
Species Human (GRCh38)
Location 6:26156459-26156481
Sequence GGCCCGCAAGTCTGCAGGTG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 125}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005470266_1005470277 21 Left 1005470266 6:26156415-26156437 CCCGCTGCTCCGGCCCCTGCCGA 0: 1
1: 0
2: 2
3: 23
4: 383
Right 1005470277 6:26156459-26156481 GGCCCGCAAGTCTGCAGGTGCGG 0: 1
1: 0
2: 0
3: 10
4: 125
1005470271_1005470277 6 Left 1005470271 6:26156430-26156452 CCTGCCGAGAAGACTCCCGTGAA 0: 1
1: 0
2: 0
3: 2
4: 38
Right 1005470277 6:26156459-26156481 GGCCCGCAAGTCTGCAGGTGCGG 0: 1
1: 0
2: 0
3: 10
4: 125
1005470268_1005470277 12 Left 1005470268 6:26156424-26156446 CCGGCCCCTGCCGAGAAGACTCC 0: 1
1: 0
2: 0
3: 16
4: 191
Right 1005470277 6:26156459-26156481 GGCCCGCAAGTCTGCAGGTGCGG 0: 1
1: 0
2: 0
3: 10
4: 125
1005470269_1005470277 8 Left 1005470269 6:26156428-26156450 CCCCTGCCGAGAAGACTCCCGTG 0: 1
1: 0
2: 0
3: 2
4: 104
Right 1005470277 6:26156459-26156481 GGCCCGCAAGTCTGCAGGTGCGG 0: 1
1: 0
2: 0
3: 10
4: 125
1005470272_1005470277 2 Left 1005470272 6:26156434-26156456 CCGAGAAGACTCCCGTGAAGAAG 0: 1
1: 0
2: 0
3: 2
4: 121
Right 1005470277 6:26156459-26156481 GGCCCGCAAGTCTGCAGGTGCGG 0: 1
1: 0
2: 0
3: 10
4: 125
1005470267_1005470277 20 Left 1005470267 6:26156416-26156438 CCGCTGCTCCGGCCCCTGCCGAG 0: 1
1: 0
2: 1
3: 39
4: 427
Right 1005470277 6:26156459-26156481 GGCCCGCAAGTCTGCAGGTGCGG 0: 1
1: 0
2: 0
3: 10
4: 125
1005470270_1005470277 7 Left 1005470270 6:26156429-26156451 CCCTGCCGAGAAGACTCCCGTGA 0: 1
1: 0
2: 0
3: 1
4: 40
Right 1005470277 6:26156459-26156481 GGCCCGCAAGTCTGCAGGTGCGG 0: 1
1: 0
2: 0
3: 10
4: 125
1005470274_1005470277 -9 Left 1005470274 6:26156445-26156467 CCCGTGAAGAAGAAGGCCCGCAA 0: 1
1: 0
2: 0
3: 6
4: 71
Right 1005470277 6:26156459-26156481 GGCCCGCAAGTCTGCAGGTGCGG 0: 1
1: 0
2: 0
3: 10
4: 125
1005470265_1005470277 26 Left 1005470265 6:26156410-26156432 CCGCGCCCGCTGCTCCGGCCCCT 0: 1
1: 0
2: 2
3: 59
4: 619
Right 1005470277 6:26156459-26156481 GGCCCGCAAGTCTGCAGGTGCGG 0: 1
1: 0
2: 0
3: 10
4: 125
1005470264_1005470277 30 Left 1005470264 6:26156406-26156428 CCTGCCGCGCCCGCTGCTCCGGC 0: 1
1: 1
2: 5
3: 76
4: 524
Right 1005470277 6:26156459-26156481 GGCCCGCAAGTCTGCAGGTGCGG 0: 1
1: 0
2: 0
3: 10
4: 125
1005470275_1005470277 -10 Left 1005470275 6:26156446-26156468 CCGTGAAGAAGAAGGCCCGCAAG 0: 1
1: 0
2: 0
3: 6
4: 109
Right 1005470277 6:26156459-26156481 GGCCCGCAAGTCTGCAGGTGCGG 0: 1
1: 0
2: 0
3: 10
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005470277 Original CRISPR GGCCCGCAAGTCTGCAGGTG CGG Exonic