ID: 1005470281

View in Genome Browser
Species Human (GRCh38)
Location 6:26156479-26156501
Sequence CGGCCAAGCGCAAAGCGTCT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 20
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 17}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005470274_1005470281 11 Left 1005470274 6:26156445-26156467 CCCGTGAAGAAGAAGGCCCGCAA 0: 1
1: 0
2: 0
3: 6
4: 71
Right 1005470281 6:26156479-26156501 CGGCCAAGCGCAAAGCGTCTGGG 0: 1
1: 0
2: 0
3: 2
4: 17
1005470275_1005470281 10 Left 1005470275 6:26156446-26156468 CCGTGAAGAAGAAGGCCCGCAAG 0: 1
1: 0
2: 0
3: 6
4: 109
Right 1005470281 6:26156479-26156501 CGGCCAAGCGCAAAGCGTCTGGG 0: 1
1: 0
2: 0
3: 2
4: 17
1005470279_1005470281 -6 Left 1005470279 6:26156462-26156484 CCGCAAGTCTGCAGGTGCGGCCA 0: 1
1: 0
2: 3
3: 6
4: 125
Right 1005470281 6:26156479-26156501 CGGCCAAGCGCAAAGCGTCTGGG 0: 1
1: 0
2: 0
3: 2
4: 17
1005470272_1005470281 22 Left 1005470272 6:26156434-26156456 CCGAGAAGACTCCCGTGAAGAAG 0: 1
1: 0
2: 0
3: 2
4: 121
Right 1005470281 6:26156479-26156501 CGGCCAAGCGCAAAGCGTCTGGG 0: 1
1: 0
2: 0
3: 2
4: 17
1005470269_1005470281 28 Left 1005470269 6:26156428-26156450 CCCCTGCCGAGAAGACTCCCGTG 0: 1
1: 0
2: 0
3: 2
4: 104
Right 1005470281 6:26156479-26156501 CGGCCAAGCGCAAAGCGTCTGGG 0: 1
1: 0
2: 0
3: 2
4: 17
1005470270_1005470281 27 Left 1005470270 6:26156429-26156451 CCCTGCCGAGAAGACTCCCGTGA 0: 1
1: 0
2: 0
3: 1
4: 40
Right 1005470281 6:26156479-26156501 CGGCCAAGCGCAAAGCGTCTGGG 0: 1
1: 0
2: 0
3: 2
4: 17
1005470278_1005470281 -5 Left 1005470278 6:26156461-26156483 CCCGCAAGTCTGCAGGTGCGGCC 0: 1
1: 0
2: 0
3: 12
4: 126
Right 1005470281 6:26156479-26156501 CGGCCAAGCGCAAAGCGTCTGGG 0: 1
1: 0
2: 0
3: 2
4: 17
1005470271_1005470281 26 Left 1005470271 6:26156430-26156452 CCTGCCGAGAAGACTCCCGTGAA 0: 1
1: 0
2: 0
3: 2
4: 38
Right 1005470281 6:26156479-26156501 CGGCCAAGCGCAAAGCGTCTGGG 0: 1
1: 0
2: 0
3: 2
4: 17

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005470281 Original CRISPR CGGCCAAGCGCAAAGCGTCT GGG Exonic