ID: 1005470283

View in Genome Browser
Species Human (GRCh38)
Location 6:26156486-26156508
Sequence GCGCAAAGCGTCTGGGCCCC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 80}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005470279_1005470283 1 Left 1005470279 6:26156462-26156484 CCGCAAGTCTGCAGGTGCGGCCA 0: 1
1: 0
2: 3
3: 6
4: 125
Right 1005470283 6:26156486-26156508 GCGCAAAGCGTCTGGGCCCCCGG 0: 1
1: 0
2: 0
3: 5
4: 80
1005470272_1005470283 29 Left 1005470272 6:26156434-26156456 CCGAGAAGACTCCCGTGAAGAAG 0: 1
1: 0
2: 0
3: 2
4: 121
Right 1005470283 6:26156486-26156508 GCGCAAAGCGTCTGGGCCCCCGG 0: 1
1: 0
2: 0
3: 5
4: 80
1005470278_1005470283 2 Left 1005470278 6:26156461-26156483 CCCGCAAGTCTGCAGGTGCGGCC 0: 1
1: 0
2: 0
3: 12
4: 126
Right 1005470283 6:26156486-26156508 GCGCAAAGCGTCTGGGCCCCCGG 0: 1
1: 0
2: 0
3: 5
4: 80
1005470275_1005470283 17 Left 1005470275 6:26156446-26156468 CCGTGAAGAAGAAGGCCCGCAAG 0: 1
1: 0
2: 0
3: 6
4: 109
Right 1005470283 6:26156486-26156508 GCGCAAAGCGTCTGGGCCCCCGG 0: 1
1: 0
2: 0
3: 5
4: 80
1005470274_1005470283 18 Left 1005470274 6:26156445-26156467 CCCGTGAAGAAGAAGGCCCGCAA 0: 1
1: 0
2: 0
3: 6
4: 71
Right 1005470283 6:26156486-26156508 GCGCAAAGCGTCTGGGCCCCCGG 0: 1
1: 0
2: 0
3: 5
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005470283 Original CRISPR GCGCAAAGCGTCTGGGCCCC CGG Exonic