ID: 1005471938

View in Genome Browser
Species Human (GRCh38)
Location 6:26169834-26169856
Sequence CTGTAGTCCTTGAGCCAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 151}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005471930_1005471938 26 Left 1005471930 6:26169785-26169807 CCCGTCTCTACTAAAAATACAAA 0: 164005
1: 210050
2: 126715
3: 67031
4: 60843
Right 1005471938 6:26169834-26169856 CTGTAGTCCTTGAGCCAAGAGGG 0: 1
1: 0
2: 1
3: 13
4: 151
1005471929_1005471938 27 Left 1005471929 6:26169784-26169806 CCCCGTCTCTACTAAAAATACAA 0: 98173
1: 216399
2: 153384
3: 81062
4: 60801
Right 1005471938 6:26169834-26169856 CTGTAGTCCTTGAGCCAAGAGGG 0: 1
1: 0
2: 1
3: 13
4: 151
1005471931_1005471938 25 Left 1005471931 6:26169786-26169808 CCGTCTCTACTAAAAATACAAAA 0: 194929
1: 143151
2: 66814
3: 37831
4: 46551
Right 1005471938 6:26169834-26169856 CTGTAGTCCTTGAGCCAAGAGGG 0: 1
1: 0
2: 1
3: 13
4: 151
1005471935_1005471938 -3 Left 1005471935 6:26169814-26169836 CCAGGCATGGTGGCATGCACCTG 0: 1803
1: 8852
2: 28337
3: 66513
4: 125504
Right 1005471938 6:26169834-26169856 CTGTAGTCCTTGAGCCAAGAGGG 0: 1
1: 0
2: 1
3: 13
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005471938 Original CRISPR CTGTAGTCCTTGAGCCAAGA GGG Intronic
900321872 1:2088484-2088506 CTCGAGTCCTTGAGTGAAGACGG + Intronic
904252238 1:29233346-29233368 CTATAATCCTTGAGAGAAGAAGG - Intergenic
904276133 1:29385509-29385531 CTGGGGTCCCTGGGCCAAGAGGG - Intergenic
904538645 1:31217875-31217897 CTGGAATCCAGGAGCCAAGAGGG - Intronic
904685913 1:32260391-32260413 CTGTAATCCTAGGGCCGAGATGG - Intronic
908103623 1:60816840-60816862 CTCTAGTCCTTTAGGTAAGATGG + Intergenic
908834678 1:68217139-68217161 GTGTTTTCCTTGAACCAAGAAGG - Intronic
913680626 1:121185366-121185388 CTGCGGTCCGTGAGCCAGGACGG - Intronic
914032457 1:143973008-143973030 CTGCGGTCCGTGAGCCAGGACGG - Intergenic
917628872 1:176873721-176873743 CTGTTATCCTTCAGCCAGGAAGG - Intronic
918181663 1:182089799-182089821 CCTGACTCCTTGAGCCAAGAAGG - Intergenic
919733485 1:200929484-200929506 TTGTTTTCCTTGAGCAAAGAGGG - Intergenic
920467937 1:206203892-206203914 CTGCGGTCCGTGAGCCAGGACGG - Intronic
922341445 1:224659108-224659130 CTATAGTCCCTGGGCCAAGAGGG + Intronic
924666839 1:246082142-246082164 CTCTGGTCCCTGAGCAAAGAGGG - Intronic
1066022243 10:31315667-31315689 CTGCAGTCATTGAGTCAGGAAGG - Intergenic
1066061576 10:31728096-31728118 CTTCAGTCCCTGAGCAAAGAGGG - Intergenic
1067400767 10:45971871-45971893 CTGGAGTCCCTGAGACCAGAAGG + Intergenic
1070748820 10:78951832-78951854 CTGTGGTCCTTGAGGCACCAGGG - Intergenic
1073677103 10:105660824-105660846 CAGTAGTTCTTGAGCTTAGAGGG + Intergenic
1081804472 11:45882966-45882988 GTGCACTCCTGGAGCCAAGAGGG + Exonic
1083459273 11:62799902-62799924 CTCTTGCCCTTGCGCCAAGAGGG - Intronic
1085469944 11:76751290-76751312 TTGTAATCCTTGAGCTAAGGAGG + Intergenic
1086687594 11:89750562-89750584 CTGTAATCCCAGCGCCAAGACGG + Intergenic
1086718258 11:90089334-90089356 CTGTAATCCCAGCGCCAAGACGG - Intergenic
1088699322 11:112397939-112397961 CTGAAGTCCTAGAGCCTGGATGG - Intergenic
1089512954 11:119012100-119012122 ATGAGGTCCTTGAGCCATGAGGG - Intronic
1091451557 12:575429-575451 CTGTAGTCCTGGAGCAGAGCAGG - Intronic
1094293342 12:28876577-28876599 ATGTTATCCTTCAGCCAAGAAGG - Intergenic
1108384553 13:49886898-49886920 CAGTAGTCCCTCAGCCTAGAGGG - Intergenic
1108434834 13:50391774-50391796 CTGTAGGCTTTGACCCTAGAAGG - Intronic
1110236442 13:73222207-73222229 CTGGAATCCTTGAGCCAGGGAGG + Intergenic
1114157420 14:20120469-20120491 CTCTAGTCCTAGAACCAAGATGG + Intergenic
1119611033 14:76062562-76062584 ATGTGGTCCTTGACTCAAGAGGG - Intronic
1120699071 14:87678108-87678130 CTGGAGTCTTTGAGCAAAGGAGG + Intergenic
1122850381 14:104525008-104525030 CCTTATTCCTTGAGCCAAAAGGG + Intronic
1122898269 14:104771267-104771289 CTGTAGTCCCTGAGCCATGGAGG - Intronic
1123945881 15:25238692-25238714 CTGGAGTTCTTGCCCCAAGAGGG + Intergenic
1127369882 15:58329920-58329942 CTGTAGGCCAGGAGCCAGGATGG - Intronic
1130050373 15:80479202-80479224 CTGGGGTCCCTGAGCCAACATGG - Intronic
1130211770 15:81930516-81930538 AGGGAGTCCTTGAGCCAAGCTGG + Intergenic
1132423772 15:101696655-101696677 CTGGGGTCCTTTGGCCAAGAGGG - Intronic
1137552352 16:49447107-49447129 CTGTAGTACTGGAGTAAAGACGG - Intergenic
1138137133 16:54532848-54532870 CAGTAGTCAGTGAGCAAAGATGG + Intergenic
1140407304 16:74719297-74719319 CTGGGGTCCTTGAGTCAAAATGG + Intronic
1142186564 16:88697626-88697648 CTGTAGTCCTGGAGACAGGAAGG + Exonic
1144961816 17:19048800-19048822 CTGGAGTCCCTGAGCCAACCAGG + Intergenic
1144973345 17:19125722-19125744 CTGGAGTCCCTGAGCCAACCAGG - Intergenic
1145986112 17:29047722-29047744 GTCTGGTCCATGAGCCAAGATGG - Intronic
1146732863 17:35210314-35210336 CTGTAGTTAGTGAGCCATGATGG + Intergenic
1148039108 17:44692074-44692096 CTATCATCCTTGAGCCATGATGG - Intergenic
1148283672 17:46369347-46369369 CTGTAGACTTTGAGTAAAGAAGG - Intergenic
1148305890 17:46587264-46587286 CTGTAGACTTTGAGTAAAGAAGG - Intergenic
1151420661 17:73995059-73995081 CTGGAGTCCTTGAAAAAAGAGGG - Intergenic
1153859353 18:9185241-9185263 CTGTAGTCAGTGAGTCAGGAGGG + Intronic
1155710083 18:28865945-28865967 GTGTAGTCTTTGAGCTAGGATGG + Intergenic
1156062825 18:33101577-33101599 CTGTATCCCATGGGCCAAGAAGG - Intronic
1156309023 18:35905763-35905785 CTGTAGACTTTGAGCCCAGATGG + Intergenic
1158139151 18:54238889-54238911 TTGTAGTCATTGAGCCTACAGGG - Intergenic
1158607761 18:58911129-58911151 CTGGAGAACTTGAGCCATGAAGG + Intronic
1158667213 18:59443293-59443315 CTGTGGCCCTTGAGCCAGCAAGG - Intronic
1158703492 18:59770467-59770489 CTGTAGTCCTTGAAGGGAGAAGG + Intergenic
1158736772 18:60091311-60091333 CTCTAGATCTTGAGCCCAGAGGG - Intergenic
1159550574 18:69891846-69891868 CATTAGTTCTTGAGCAAAGATGG - Intronic
1159969608 18:74633240-74633262 CTTTATTCATTGAGCAAAGAAGG + Exonic
1160394754 18:78563499-78563521 CAGGAGTCCTTGAACCAGGAGGG - Intergenic
1163115008 19:15183951-15183973 CTGAGGTGCTTGAGCCCAGAAGG + Intronic
1164754310 19:30678635-30678657 CTGGACTCCTAGAGCCAAGCAGG + Intronic
1165133251 19:33646557-33646579 CTTTAGTCCCTGAGCAAGGAGGG + Intronic
1165136924 19:33675360-33675382 CTGTAGCCATTGAACCATGAAGG + Intronic
1167442418 19:49516058-49516080 CTCTGGGCCTTGAGCAAAGAGGG + Intronic
1167908698 19:52683863-52683885 CTGTTGTCCTGTGGCCAAGATGG + Intronic
926573394 2:14554162-14554184 CTGTTGTCTATGAGCCAAGACGG + Intergenic
930454301 2:51585355-51585377 ATTTATTCCTTGAGGCAAGATGG - Intergenic
933013837 2:77098390-77098412 CTGGAGTCTTTGGGACAAGATGG + Intronic
933636031 2:84709845-84709867 CTGTAGTCCTTGTTCCTAAAAGG + Intronic
937239246 2:120449735-120449757 CTGAAGTCCTTGATGCAAGAAGG + Intergenic
939752755 2:146067838-146067860 CTGTGGTCCTTGAGAGAAGGAGG + Intergenic
948669142 2:239555448-239555470 CAGTGGTCCTTCAGCCAGGAGGG + Intergenic
948996532 2:241583024-241583046 CTGTACTCCAGGAGCCAAGGGGG - Intergenic
1172289778 20:33767604-33767626 CTGTTATCCGTGAGCCAAAAGGG + Intronic
1172574479 20:35997150-35997172 CTGGGGTCCTTGACCCAAGTGGG - Intronic
1172716957 20:36971652-36971674 CAATAGTCCGTGAGCCTAGAGGG - Intergenic
1174682428 20:52421660-52421682 CTGTAGTCCTTGAGTCAAAAAGG - Intergenic
1175379806 20:58554952-58554974 GTGTAGACCTTGCCCCAAGAGGG + Intergenic
1176038635 20:63052594-63052616 CTGGAGTCCTGGAGCTCAGAGGG + Intergenic
1183368029 22:37417492-37417514 CTGGGGTCCTTGAGCCAACAGGG + Intronic
950551184 3:13666771-13666793 TTGTGGTCCTATAGCCAAGAGGG - Intergenic
951090051 3:18561889-18561911 CTGTAATAGTTGAGTCAAGAAGG - Intergenic
952658561 3:35817377-35817399 GTGTGGGCCATGAGCCAAGAAGG + Intergenic
952960993 3:38588992-38589014 CTTTAGTGCTTGTGCCCAGAGGG + Intronic
953795982 3:45986370-45986392 CTGGACTCCTGGAGCCACGAGGG - Intronic
954691680 3:52399058-52399080 CTGCAGGCCTGGATCCAAGATGG + Exonic
955060944 3:55490905-55490927 CTGAAGTCCTTGGGACTAGACGG - Intergenic
959596626 3:108136142-108136164 CTGTAGTACTTTCCCCAAGAAGG - Intergenic
959669000 3:108953759-108953781 CTGTAGACTGTGAGTCAAGATGG - Exonic
961343027 3:126242842-126242864 CCGTAGTCATTGAGACAATATGG + Intergenic
961666164 3:128494111-128494133 CTGGGGACCTTGAGCCCAGAGGG + Intergenic
963242112 3:143016433-143016455 CTGCAGTCATTCAACCAAGATGG - Intronic
963743985 3:149108077-149108099 CTATAGTCCCTGGGCCTAGAGGG + Intergenic
967320957 3:188194598-188194620 CTGTAGTTCTTGAGGGAAGAAGG + Intronic
973074025 4:45900452-45900474 TTTTAGTCCCTGAGCAAAGAGGG + Intergenic
977567992 4:98600927-98600949 CTGTAGTCCATGAATCAAGGAGG - Intronic
979077119 4:116285869-116285891 CTTTGGTCCTTGAGGCAATATGG - Intergenic
981206896 4:142052946-142052968 CTTTAGTCTTTGAGCCCTGAAGG - Intronic
981849021 4:149206015-149206037 CTGTATTCCTCGAGCTTAGACGG - Intergenic
984066287 4:175052032-175052054 CAATAGTCCTTGGGCCTAGAGGG + Intergenic
985692875 5:1323302-1323324 CTGCTGGCCCTGAGCCAAGAGGG - Intronic
988394843 5:30683559-30683581 CAGTATTGCTTGAGCCAAGGAGG + Intergenic
988681947 5:33492111-33492133 CTTTGGTCCTTGAGCAAGGAGGG + Intergenic
988832059 5:34997576-34997598 CTGTAGAGATTGAGCCAGGAAGG - Intergenic
992351506 5:75933684-75933706 CAGTTGGCCTGGAGCCAAGATGG - Intergenic
992869661 5:80993677-80993699 CTGTAGGCCTGAAGGCAAGAGGG + Intronic
993132339 5:83914703-83914725 ATTTAGTCATTGAGCCAAGGTGG + Intergenic
993680059 5:90866008-90866030 CTGTGGTTCTTTAGCTAAGAGGG + Intronic
993914770 5:93730881-93730903 CTGTAATTCTTCAGCCCAGAAGG + Intronic
995598932 5:113775512-113775534 CTGTGGTACTTGAGCCAGGAGGG + Intergenic
995713987 5:115063694-115063716 CTTCACTCCTTGAGCCAACAGGG - Intergenic
997979743 5:138461552-138461574 CTGTAGTGATTGAGTCAGGATGG - Intergenic
1000131598 5:158305304-158305326 TTGTAGTCCCTGTGCAAAGAGGG + Intergenic
1001189879 5:169620049-169620071 CTGGTGTGCTGGAGCCAAGATGG + Intergenic
1001193347 5:169650688-169650710 CTGGAGTCAGTGACCCAAGATGG + Intronic
1001426195 5:171624100-171624122 TCGTAGTCCTTAAGCCAAGTGGG + Intergenic
1003062426 6:2874190-2874212 CTGTAGTCATTTAACTAAGAAGG + Intergenic
1003564207 6:7208696-7208718 CTGCAGTCCTTGAGCAAAACTGG + Intronic
1004321482 6:14634861-14634883 CCGTAGTCTTTGAGCAAAGCAGG + Intergenic
1005471938 6:26169834-26169856 CTGTAGTCCTTGAGCCAAGAGGG + Intronic
1006596046 6:35193054-35193076 CTGGAGTCTTGGAGCAAAGAAGG - Intergenic
1008414475 6:51224340-51224362 TTTTAGGCCTGGAGCCAAGATGG + Intergenic
1009634151 6:66242356-66242378 CTGTAGTCCTACAGCCACAATGG + Intergenic
1010318335 6:74476288-74476310 CTGTATTCCCAGTGCCAAGAAGG - Intergenic
1011667530 6:89648897-89648919 CTGTACTGCTTAAGCCCAGAAGG + Intronic
1016534239 6:145092708-145092730 ATGTTGTCAATGAGCCAAGAAGG - Intergenic
1023494755 7:40783257-40783279 TTTTAGTCCTGGAGCTAAGAGGG + Intronic
1024148529 7:46542814-46542836 TTATAGTCCTTGAGCCTGGAGGG - Intergenic
1024152444 7:46586310-46586332 CTGTAGTCCTTGACACATAATGG + Intergenic
1032272439 7:130422487-130422509 CTGCAGCCCTTTAGCCAACAGGG - Intronic
1033684093 7:143622981-143623003 CTGAAGTCATTTATCCAAGAGGG + Intronic
1033687269 7:143702200-143702222 CTGAAGTCATTTATCCAAGAGGG + Intronic
1033700519 7:143834642-143834664 CTGAAGTCATTTATCCAAGAGGG - Intergenic
1036644907 8:10607011-10607033 CTGGAGTCCTTGAGCCCAAAGGG + Exonic
1038244661 8:25844393-25844415 CTTTTGTCCTTGTCCCAAGAGGG + Exonic
1040756695 8:50783832-50783854 CTGAAGTTCTGGAGCCAAGATGG - Intronic
1042574632 8:70204509-70204531 CTGTAATCCTTGTGCAAGGATGG + Intronic
1048283767 8:133125183-133125205 CTATAGTCTTTGTCCCAAGAAGG - Intronic
1048822653 8:138394087-138394109 CTGTGGTCCTTCAGCAAAGTTGG + Intronic
1050616154 9:7403750-7403772 ATCTAGTCCTTGAGTAAAGATGG - Intergenic
1050731768 9:8717067-8717089 CTGATGTCCTTGAGCCCAGAAGG + Intronic
1051409597 9:16775855-16775877 CTGTAGTCCTTGCAACACGAAGG + Intronic
1051411068 9:16789916-16789938 CTGTATTTATTGAGCCAAGTAGG - Intronic
1051899107 9:22019372-22019394 CTAAAGTGCCTGAGCCAAGATGG + Intronic
1054936863 9:70697418-70697440 CTCTCTTCCTTGAGCCAATATGG + Intronic
1057421900 9:94919481-94919503 CTGTAGTCCTGAAGCCAAAGTGG - Intronic
1057803130 9:98201954-98201976 CTGAATCCCTTGAGCCAAGCAGG + Intronic
1187433577 X:19246943-19246965 CTGTAGCCCTGGAGTGAAGAGGG - Intergenic
1188256952 X:27974269-27974291 CAACAGTCCTTGAGCCAAAATGG + Intergenic
1189342807 X:40217457-40217479 CTGTAGCTCATGACCCAAGATGG + Intergenic
1190657313 X:52623623-52623645 CTGTAGTCCTGGGGCCGAGGCGG - Intergenic
1191170880 X:57445900-57445922 CTGTAGTCCTTGAGGTCTGATGG + Intronic
1193538448 X:82741452-82741474 CAGTAGTCCCTGGGCCTAGAGGG + Intergenic
1193884576 X:86969621-86969643 CTGGAGTTCGCGAGCCAAGATGG + Intergenic
1194308501 X:92276329-92276351 CTTTAGCCATTAAGCCAAGAAGG + Intronic
1194585685 X:95731115-95731137 CTGGAGTCCTTGAGGTAAGCAGG + Intergenic
1195253860 X:103074951-103074973 CTGCAGTCGTTGAGATAAGATGG - Intergenic
1197256610 X:124270031-124270053 CTGTATTCCTTGCCCCTAGAGGG - Intronic
1201739450 Y:17307774-17307796 CTGTTTTCCTTGAGCCCAGGAGG - Intergenic