ID: 1005472484

View in Genome Browser
Species Human (GRCh38)
Location 6:26175337-26175359
Sequence GGGATCTAGGAGGAAATAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005472480_1005472484 -9 Left 1005472480 6:26175323-26175345 CCTTTGTTTGCCTAGGGATCTAG No data
Right 1005472484 6:26175337-26175359 GGGATCTAGGAGGAAATAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005472484 Original CRISPR GGGATCTAGGAGGAAATAGA AGG Intergenic
No off target data available for this crispr