ID: 1005473922

View in Genome Browser
Species Human (GRCh38)
Location 6:26188931-26188953
Sequence GGCGGCGTCAAGCGTATTTC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 27
Summary {0: 1, 1: 0, 2: 4, 3: 7, 4: 15}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005473922_1005473932 9 Left 1005473922 6:26188931-26188953 CCAGAAATACGCTTGACGCCGCC 0: 1
1: 0
2: 4
3: 7
4: 15
Right 1005473932 6:26188963-26188985 CAGGCGGCGGATAGCGGGCTTGG 0: 1
1: 0
2: 1
3: 6
4: 80
1005473922_1005473925 -7 Left 1005473922 6:26188931-26188953 CCAGAAATACGCTTGACGCCGCC 0: 1
1: 0
2: 4
3: 7
4: 15
Right 1005473925 6:26188947-26188969 CGCCGCCGCGGCGAGCCAGGCGG 0: 1
1: 0
2: 1
3: 13
4: 163
1005473922_1005473924 -10 Left 1005473922 6:26188931-26188953 CCAGAAATACGCTTGACGCCGCC 0: 1
1: 0
2: 4
3: 7
4: 15
Right 1005473924 6:26188944-26188966 TGACGCCGCCGCGGCGAGCCAGG 0: 1
1: 0
2: 3
3: 13
4: 92
1005473922_1005473927 -4 Left 1005473922 6:26188931-26188953 CCAGAAATACGCTTGACGCCGCC 0: 1
1: 0
2: 4
3: 7
4: 15
Right 1005473927 6:26188950-26188972 CGCCGCGGCGAGCCAGGCGGCGG 0: 1
1: 0
2: 3
3: 26
4: 726
1005473922_1005473933 20 Left 1005473922 6:26188931-26188953 CCAGAAATACGCTTGACGCCGCC 0: 1
1: 0
2: 4
3: 7
4: 15
Right 1005473933 6:26188974-26188996 TAGCGGGCTTGGTGATTCCTTGG 0: 1
1: 0
2: 0
3: 1
4: 45
1005473922_1005473929 3 Left 1005473922 6:26188931-26188953 CCAGAAATACGCTTGACGCCGCC 0: 1
1: 0
2: 4
3: 7
4: 15
Right 1005473929 6:26188957-26188979 GCGAGCCAGGCGGCGGATAGCGG 0: 1
1: 0
2: 0
3: 3
4: 70
1005473922_1005473930 4 Left 1005473922 6:26188931-26188953 CCAGAAATACGCTTGACGCCGCC 0: 1
1: 0
2: 4
3: 7
4: 15
Right 1005473930 6:26188958-26188980 CGAGCCAGGCGGCGGATAGCGGG 0: 1
1: 0
2: 1
3: 6
4: 48

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005473922 Original CRISPR GGCGGCGTCAAGCGTATTTC TGG (reversed) Exonic
914665971 1:149832808-149832830 GGCGGCGTTAAGCGGATCTCTGG + Intergenic
914669794 1:149860986-149861008 GGCGGCGTTAAGCGGATCTCTGG - Exonic
1076077847 10:127551018-127551040 GGTGGCATCATGAGTATTTCTGG + Intronic
1093077269 12:14770939-14770961 GGGGGCGTCAAGCGCATTTCTGG - Exonic
1134592164 16:15463392-15463414 GATGCCTTCAAGCGTATTTCAGG - Intronic
1152823825 17:82450890-82450912 GGCGGAGCCGAGCGGATTTCCGG + Intergenic
1169763658 20:9125066-9125088 GATGGAGTCAAGCGTATTTCAGG - Intronic
1172252761 20:33490868-33490890 GTCGGTGTCAAGCGTTTTACTGG - Intronic
1174177893 20:48656582-48656604 GGGGGAGTCAAGGGGATTTCTGG - Intronic
1185039424 22:48496944-48496966 GGGGGCGCCAAGCCTCTTTCTGG - Intronic
969019960 4:4133212-4133234 GGTGACGTCAAGAGTCTTTCTGG + Intergenic
978168035 4:105632303-105632325 TGCTGTGTCAAGCGTAGTTCTGG + Intronic
986333663 5:6736729-6736751 GGCGGCGTGAGGCGTCTTCCAGG + Intronic
1005456189 6:26021802-26021824 GGCGGTGTGAAGCGGATCTCTGG + Exonic
1005456722 6:26027107-26027129 GGTGGGGTTAAGCGAATTTCCGG - Exonic
1005464977 6:26104071-26104093 GGTGGCGTCAAGCGCATTTCCGG + Exonic
1005473922 6:26188931-26188953 GGCGGCGTCAAGCGTATTTCTGG - Exonic
1005475619 6:26204768-26204790 GGGGGTGTCAAGCGCATTTCTGG + Exonic
1005479324 6:26240549-26240571 GGCGGCGTGAAACGCATTTCGGG + Exonic
1005480012 6:26246832-26246854 GGCGGTGTCAAGCGCATCTTGGG - Exonic
1005484324 6:26285354-26285376 GGCGGTGTCAAGCGAATTTCTGG - Exonic
1005570361 6:27139432-27139454 GGCGGCGTGAAGCGCATTTCTGG + Exonic
1005643994 6:27824248-27824270 GGCGGCGTGAAGCGCATCTCCGG + Exonic
1005645203 6:27831382-27831404 GGCGGCGTGAAGCGCATCTCCGG - Exonic
1005649457 6:27873365-27873387 GGAGGCGTTAAGCGCATCTCAGG - Exonic
1052116022 9:24649213-24649235 GGCTGAGTCAAGGGTATTTATGG - Intergenic
1201964089 Y:19712586-19712608 GGCAGCCTCAAAAGTATTTCAGG + Intronic