ID: 1005473924

View in Genome Browser
Species Human (GRCh38)
Location 6:26188944-26188966
Sequence TGACGCCGCCGCGGCGAGCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 92}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005473922_1005473924 -10 Left 1005473922 6:26188931-26188953 CCAGAAATACGCTTGACGCCGCC 0: 1
1: 0
2: 4
3: 7
4: 15
Right 1005473924 6:26188944-26188966 TGACGCCGCCGCGGCGAGCCAGG 0: 1
1: 0
2: 3
3: 13
4: 92
1005473921_1005473924 4 Left 1005473921 6:26188917-26188939 CCTCATAAATGAGGCCAGAAATA 0: 1
1: 0
2: 3
3: 28
4: 292
Right 1005473924 6:26188944-26188966 TGACGCCGCCGCGGCGAGCCAGG 0: 1
1: 0
2: 3
3: 13
4: 92
1005473919_1005473924 14 Left 1005473919 6:26188907-26188929 CCGCGAGTTTCCTCATAAATGAG 0: 1
1: 0
2: 1
3: 15
4: 99
Right 1005473924 6:26188944-26188966 TGACGCCGCCGCGGCGAGCCAGG 0: 1
1: 0
2: 3
3: 13
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005473924 Original CRISPR TGACGCCGCCGCGGCGAGCC AGG Exonic
900087374 1:904940-904962 GGACTCCGCCGCGGGGAGGCGGG + Intergenic
902414290 1:16229966-16229988 TGACCCCCCCACGGCGAGGCAGG - Intergenic
902520307 1:17011904-17011926 TGTCGGAGCCGCGCCGAGCCTGG - Intronic
912955579 1:114152709-114152731 AGACGCCGCAGCTGCGCGCCAGG + Exonic
913205526 1:116534637-116534659 CAGCGCCGCCGCGGCGGGCCTGG - Intronic
916101894 1:161399920-161399942 TGACCCCGCCGCGAGCAGCCCGG - Intergenic
916524604 1:165598027-165598049 TGGCTCCGCCTCGGCTAGCCGGG - Intergenic
921472610 1:215567373-215567395 CGACGCCGCCGCAGCCTGCCTGG - Exonic
923612009 1:235504254-235504276 GGCCGCCCCCGCCGCGAGCCGGG + Exonic
1062874028 10:931314-931336 GGACGCGGCCGCGGCGGGCAGGG - Intronic
1074340621 10:112625353-112625375 TGAAGCCGCCGCGCCCGGCCTGG - Intronic
1081699946 11:45146700-45146722 CGCCGCCGCCGCGCCGAGGCTGG + Intronic
1085208099 11:74749162-74749184 CGCCGCCGACGCGGCGGGCCCGG + Exonic
1090699152 11:129279159-129279181 GGACGCCGCGGCGGCGCGGCGGG - Intronic
1091696945 12:2633998-2634020 TGTGGCCGCCCCGGGGAGCCGGG - Intronic
1096598671 12:52714390-52714412 TGCCGCCGCCGCCGCCACCCCGG + Intergenic
1105472066 13:20703731-20703753 CGCCGCCGCCGCCCCGAGCCGGG - Intronic
1106517147 13:30465330-30465352 GGCCGCCGCCGCAGCGAGCCGGG - Intronic
1112344404 13:98577414-98577436 GGCCGGCGCCGGGGCGAGCCTGG + Intronic
1116905087 14:50396634-50396656 CGCCGCCTCCGCGGGGAGCCGGG - Intronic
1117680682 14:58200082-58200104 TCGCGCGGCCGCGGCGCGCCGGG - Intronic
1125535909 15:40441151-40441173 TGACGCAGCAGCGTGGAGCCCGG + Intronic
1126766997 15:52019425-52019447 GGAGGGCGCCGCGGCGGGCCCGG + Intronic
1128028573 15:64460584-64460606 CGCCGCCGCCGCCGCGATCCGGG - Intergenic
1128830404 15:70763329-70763351 TGGCGCCGCCGCCGCCAGCGCGG - Exonic
1130979447 15:88803023-88803045 TGAGGCCGCCGCGGCGGGACAGG - Intergenic
1132552707 16:560031-560053 TCACGCCGCGGCGGGGACCCGGG + Intergenic
1132839466 16:1972043-1972065 TGACGCCATCGCAGCGCGCCGGG + Exonic
1132915305 16:2340653-2340675 TGCCGCCGCCACTGCGAGGCTGG - Exonic
1135821887 16:25692388-25692410 CGCCGCCGCCGCCGCGAGCCGGG + Exonic
1138360751 16:56425442-56425464 CGCCGCCGCCGCGCCGGGCCGGG + Exonic
1138598443 16:58041662-58041684 TGACGCCACGGCGGCCAGGCCGG + Exonic
1141989613 16:87602591-87602613 TGCCGCCGCCGCCCCGCGCCCGG + Intronic
1142346993 16:89560565-89560587 TGACGTCGCCGCGGCTCTCCCGG - Intergenic
1142811796 17:2399017-2399039 TGCCGCCGCCGCGGCGGGCGGGG - Intronic
1143582667 17:7835784-7835806 TTGCGCCTGCGCGGCGAGCCGGG + Intergenic
1146433637 17:32822586-32822608 GGAGGCGGCCGCGCCGAGCCGGG + Intronic
1147400417 17:40177555-40177577 TGCCGCCGCAGCGCAGAGCCGGG + Intronic
1151537582 17:74747719-74747741 TGAGGGCTCCGCGGAGAGCCTGG - Intergenic
1153238767 18:3012874-3012896 TGGCGCGGTCGCGGCGAGGCGGG + Intronic
1158478975 18:57803705-57803727 TGGCGGGGCCGCGGCGCGCCCGG + Intergenic
1160960605 19:1719048-1719070 TGCCGCCGCCGCAGCGGGGCTGG + Intergenic
1161063520 19:2226846-2226868 GGACGCCGCCGGGGCCAGGCCGG - Exonic
1161667859 19:5587886-5587908 GGACGCAGGCGCGGCTAGCCGGG - Exonic
1161999544 19:7734675-7734697 TGAAGCTGCCTTGGCGAGCCAGG + Intergenic
1162006551 19:7784067-7784089 TGAAGCTGCCTTGGCGAGCCAGG - Intergenic
1167384276 19:49155076-49155098 TGATGCCTCCTCGGAGAGCCCGG + Exonic
926784738 2:16508333-16508355 AGACGCCGCAGCGGCGGGGCAGG - Intergenic
932773981 2:74516167-74516189 TCACACCACCGAGGCGAGCCCGG - Exonic
938290186 2:130144923-130144945 TGGCGCCGGCGCCGAGAGCCCGG + Exonic
938466343 2:131528022-131528044 TGGCGCCGGCGCCGAGAGCCCGG - Exonic
942278096 2:174336949-174336971 TGCCGCCGCCGGGGGGAGCTCGG + Exonic
944104810 2:196068655-196068677 CGTCGCGGCGGCGGCGAGCCTGG + Intronic
946325333 2:218981915-218981937 TGCCGCCGCCGCGGCCGCCCAGG - Exonic
947593058 2:231395924-231395946 TGAGGCCGGCGCGGCGCGCGCGG - Intronic
948467434 2:238159067-238159089 GGCCGCCGCCGCCGCGGGCCTGG + Exonic
948874660 2:240820219-240820241 TGACGGCGCCGCCGCGTGACGGG + Exonic
1175349802 20:58309757-58309779 GGACGCCGCCGCGGCCTTCCGGG - Exonic
1176550581 21:8219199-8219221 GGAGGCGGCCGCGCCGAGCCGGG + Intergenic
1176569511 21:8402240-8402262 GGAGGCGGCCGCGCCGAGCCGGG + Intergenic
1176577423 21:8446469-8446491 GGAGGCGGCCGCGCCGAGCCGGG + Intergenic
1182149781 22:28019945-28019967 TGAGGCCGCCGTGGCAGGCCTGG - Intronic
1182903977 22:33920822-33920844 TGCAGCCGCCGCGGGCAGCCGGG + Intronic
1185055261 22:48575859-48575881 CACCGCCGCCGCGGCGGGCCAGG - Intronic
1185246855 22:49777269-49777291 TGACACCCCCGCGGCCAGACGGG + Intronic
1203255480 22_KI270733v1_random:135542-135564 GGAGGCGGCCGCGCCGAGCCGGG + Intergenic
952905440 3:38136867-38136889 TGAAGCCGCCGCGGCCCGCCCGG + Exonic
968474148 4:795278-795300 AGACGCCGGAGCGGCGAGACCGG + Intronic
968605401 4:1532853-1532875 TGACACGGCCACGGCGACCCAGG + Intergenic
986858943 5:11904215-11904237 TGTCGCCGCGGGCGCGAGCCTGG + Intergenic
992124357 5:73626008-73626030 TGATGCGGCCGCCGCGAGCCGGG + Intergenic
996398489 5:123036023-123036045 TGAAGCCACCGCGGCCAGCGTGG + Intronic
998119138 5:139561694-139561716 TGAGGCCGCCTCGGCGATCTCGG - Exonic
1002140485 5:177134370-177134392 CGACGCCGCCGCCGCCTGCCCGG - Intronic
1002401738 5:178994921-178994943 TGGCGCGGCCCCGGAGAGCCCGG - Exonic
1002532729 5:179858363-179858385 GGACGCCGCCGCGGCGCGCTCGG + Intronic
1005473924 6:26188944-26188966 TGACGCCGCCGCGGCGAGCCAGG + Exonic
1005475618 6:26204755-26204777 TGACACCCCCGCGACGAGCAAGG - Exonic
1005484325 6:26285367-26285389 TGACACCGCCGCGACGAGCAAGG + Exonic
1005570359 6:27139419-27139441 TCACGCCGCCGCGGCGAGCAAGG - Exonic
1005643992 6:27824235-27824257 TCACGCCGCCGCGGCGAGCAAGG - Exonic
1005645205 6:27831395-27831417 TCACGCCGCCGCGGCGAGCAAGG + Exonic
1007788915 6:44297791-44297813 TGCCGCTGCCGCTGCGCGCCAGG + Intronic
1011272462 6:85593555-85593577 TAACGCCGCAGCGCGGAGCCTGG - Intronic
1018891532 6:167986335-167986357 TGACGCCGCCGCCGCAGGACAGG - Intergenic
1019100773 6:169627574-169627596 TGAGGCTCCCGAGGCGAGCCAGG + Intronic
1019689578 7:2403320-2403342 TGACTCCGCCCCGGCGGACCGGG - Intergenic
1021106562 7:16645467-16645489 CGACGCGGCCGCGGCCAGCCTGG - Intronic
1023067279 7:36390178-36390200 GGCCGCAGCCGCGGCGACCCCGG - Intronic
1024400997 7:48924560-48924582 GGAGGCCGCCGCGGCCAGTCAGG - Intergenic
1032068776 7:128791436-128791458 AGAAGCCGCAGCCGCGAGCCCGG - Intronic
1034984259 7:155497571-155497593 AGATGCCGCGGCGGCCAGCCTGG + Intronic
1035401711 7:158570123-158570145 AGACGGCTCCGCGGAGAGCCTGG - Intronic
1041059396 8:54021926-54021948 GGACGCGGGCGCGGCGGGCCCGG + Intronic
1044569386 8:93700514-93700536 TCGCGCCGCCGCGGCAGGCCGGG - Exonic
1044599707 8:93991551-93991573 TGCCCCCGCCGCGGGGAGCCGGG - Intergenic
1045063427 8:98426821-98426843 TGTCGGCCCCGCGCCGAGCCGGG + Intronic
1045564365 8:103298796-103298818 CGCCGCCGCCGCCGCGAGCCCGG + Intronic
1049803522 8:144528857-144528879 TGGCGCGGTCGCGGGGAGCCCGG - Exonic
1055090984 9:72364790-72364812 TGGTGCCGCCGCCGCGGGCCGGG + Intronic
1057358021 9:94347653-94347675 GGAGGCAGCCGCGGCGAGCAAGG + Intergenic
1057489129 9:95508310-95508332 TGCCGCCGCCGCCGCGGTCCTGG + Exonic
1057649728 9:96909964-96909986 GGAGGCAGCCGCGGCGAGCAAGG - Intronic
1061009208 9:127945396-127945418 AGAAGCCGCCGCGGCCACCCCGG - Exonic
1061623003 9:131823940-131823962 TGGGGCCGCCGCGGAGAGCCCGG + Intergenic
1062574711 9:137200757-137200779 AGCCGCCGCCGCGGCCAGCCTGG + Exonic
1203471876 Un_GL000220v1:118677-118699 GGAGGCGGCCGCGCCGAGCCGGG + Intergenic
1186514690 X:10158409-10158431 TGACGCCCTCGGGGCGAGGCAGG - Exonic
1189324042 X:40102456-40102478 CGACGCCGCCGCGCTGGGCCGGG + Intronic