ID: 1005473925

View in Genome Browser
Species Human (GRCh38)
Location 6:26188947-26188969
Sequence CGCCGCCGCGGCGAGCCAGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 163}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005473922_1005473925 -7 Left 1005473922 6:26188931-26188953 CCAGAAATACGCTTGACGCCGCC 0: 1
1: 0
2: 4
3: 7
4: 15
Right 1005473925 6:26188947-26188969 CGCCGCCGCGGCGAGCCAGGCGG 0: 1
1: 0
2: 1
3: 13
4: 163
1005473921_1005473925 7 Left 1005473921 6:26188917-26188939 CCTCATAAATGAGGCCAGAAATA 0: 1
1: 0
2: 3
3: 28
4: 292
Right 1005473925 6:26188947-26188969 CGCCGCCGCGGCGAGCCAGGCGG 0: 1
1: 0
2: 1
3: 13
4: 163
1005473919_1005473925 17 Left 1005473919 6:26188907-26188929 CCGCGAGTTTCCTCATAAATGAG 0: 1
1: 0
2: 1
3: 15
4: 99
Right 1005473925 6:26188947-26188969 CGCCGCCGCGGCGAGCCAGGCGG 0: 1
1: 0
2: 1
3: 13
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005473925 Original CRISPR CGCCGCCGCGGCGAGCCAGG CGG Exonic
900162926 1:1232843-1232865 CGCGGCCGCGTCAAGCCGGGGGG + Exonic
900349568 1:2228217-2228239 CGCCGCCGGGACGAGCCGGGCGG + Intergenic
900349740 1:2228680-2228702 CGCCGCCGGGGCGCGCGGGGCGG + Exonic
900573853 1:3373405-3373427 CACCTCCTCGGGGAGCCAGGGGG + Intronic
900623826 1:3599190-3599212 CACCGCTGCTGTGAGCCAGGTGG + Intronic
901131284 1:6963422-6963444 TGCCGCTGCGGGGCGCCAGGCGG - Intronic
901251604 1:7783975-7783997 CGCCCCGGCGCCGTGCCAGGGGG + Intergenic
902520306 1:17011901-17011923 CGGAGCCGCGCCGAGCCTGGTGG - Intronic
903829123 1:26164416-26164438 CGCCGCCGCCGCCTGCGAGGGGG + Intergenic
904039387 1:27575469-27575491 CGCCTCCGCGGCGAGGGTGGTGG - Intronic
904318301 1:29680233-29680255 CACCCCTGCGGCGGGCCAGGGGG - Intergenic
905037983 1:34929784-34929806 CGCCCCCGCGCGGACCCAGGAGG + Intergenic
905108372 1:35577236-35577258 AGCTGCGGCGGCGAGGCAGGTGG + Intronic
908473811 1:64470112-64470134 AGCCGCCGCGGCGGCCCAGCCGG + Intergenic
921024043 1:211260540-211260562 CGGCGCCGGGGCGAGCGAGGTGG - Intronic
922116451 1:222618302-222618324 CGCCGCCGCGGAGACCCCCGGGG - Intronic
922240843 1:223754796-223754818 CGCCCCCTCGGTGAGCCCGGAGG - Intronic
922951031 1:229558621-229558643 AGCCGCAGCGGCCAGGCAGGGGG + Exonic
923171663 1:231422307-231422329 CGGCCCCGCGGCGACCCGGGCGG + Exonic
1066994604 10:42552375-42552397 CGACGCAGAGGCGAGCGAGGTGG - Intergenic
1071260138 10:83912323-83912345 AGCCACCGCGCCCAGCCAGGGGG + Intergenic
1073325572 10:102642670-102642692 CGCCGCCGCCGCGAGGAAGGCGG - Intergenic
1075031905 10:119029644-119029666 GGCCGCGGCGGCGAGGCCGGGGG + Intergenic
1075519707 10:123136254-123136276 CGCTGCCGCGGCGGCCAAGGGGG + Exonic
1076864454 10:133160164-133160186 GGCCTCCGCGGGGAGCCACGGGG - Intergenic
1077137325 11:1007426-1007448 CGCTGCCGCCTCGAGCCAAGTGG - Intronic
1083265762 11:61546206-61546228 GGCCGCCGCGGCGGGGCTGGCGG - Exonic
1083664578 11:64267517-64267539 CGCTGACTCGGAGAGCCAGGAGG + Exonic
1083747696 11:64744805-64744827 CGCAGCCGCAGCGAGGCCGGCGG - Intronic
1084968156 11:72755152-72755174 CGCCGCCCCGCCGGGTCAGGGGG + Intronic
1085346026 11:75768708-75768730 CGCCGACGCGGCGGGCGGGGCGG - Intronic
1087761911 11:102110956-102110978 GGCACCCGCGGCGACCCAGGCGG + Exonic
1089499904 11:118925773-118925795 CGCCGCCGCCCGGAGCCAGCCGG - Intronic
1091230320 11:133984050-133984072 CCCTTCCGCGGCGCGCCAGGAGG - Intergenic
1091688992 12:2583138-2583160 CGGCGCCGCTGCGGGCCCGGAGG - Intronic
1091696944 12:2633995-2634017 GGCCGCCCCGGGGAGCCGGGCGG - Intronic
1092518442 12:9240427-9240449 GGCGGCTGCGGCGAGCAAGGAGG + Intergenic
1092796037 12:12111029-12111051 GGCGGCTGCGGCGAGCAAGGAGG - Intronic
1096713371 12:53474982-53475004 CCCCGCTGTGGCGAGCGAGGGGG - Intronic
1097155094 12:57006523-57006545 GGCCGTCGCGGCGAGCCGCGCGG - Intergenic
1098426086 12:70366615-70366637 CGCCGCCGCCGCGCGACAGCAGG - Exonic
1098943037 12:76559439-76559461 CGGCGCCGCGGCGACCTCGGAGG - Exonic
1100391512 12:94149112-94149134 AGCCATCGCGGCGAGCCAGGAGG + Exonic
1104720495 12:131042689-131042711 CGCAGCCCAGGTGAGCCAGGAGG + Intronic
1104841453 12:131828032-131828054 CGCCGCCGCAGCGCAGCAGGTGG - Intergenic
1106269362 13:28138710-28138732 CACCGCCGCCGCCAGCGAGGAGG - Exonic
1110965481 13:81689934-81689956 GGCGGCTGCGGCGAGCAAGGAGG - Intergenic
1112415360 13:99200167-99200189 CCCCGGCCCGGCGAGCCCGGCGG - Intergenic
1113480375 13:110615894-110615916 CGTCGCCGCGCCGTTCCAGGAGG - Intronic
1114643775 14:24242269-24242291 CGCCGCCGCGGCTAGCTGGCAGG - Exonic
1116905085 14:50396631-50396653 CGCCTCCGCGGGGAGCCGGGAGG - Intronic
1117135419 14:52730397-52730419 CGCCGCCGCAGCCAGCCCGAGGG + Exonic
1122389004 14:101367738-101367760 CCCCGCTGCTGGGAGCCAGGAGG + Intergenic
1122942049 14:104985860-104985882 CGCCGAGGCGGCGACCAAGGTGG + Exonic
1124575440 15:30903869-30903891 CGCCGGCGCGCGGAGCCAGGTGG + Exonic
1125834268 15:42736510-42736532 TGCCCCCGCGGCGGGCCAGAGGG + Exonic
1126766998 15:52019428-52019450 GGGCGCCGCGGCGGGCCCGGCGG + Intronic
1130076692 15:80695621-80695643 CGCCGCCGCCGCGGCCCAGCCGG + Exonic
1130115307 15:81000963-81000985 GGCGGCGGCGGCGAGCCCGGGGG + Exonic
1130335331 15:82952820-82952842 GGCCGCGGCAGCGAGCCAAGAGG + Intronic
1132105428 15:99059373-99059395 CCCAGGCGCGGGGAGCCAGGCGG + Intergenic
1133220184 16:4316314-4316336 CGCAGCCCCGGCGCGACAGGCGG - Intronic
1136365482 16:29807243-29807265 CGCCGCCGCGGCGATAGTGGCGG - Exonic
1136454609 16:30373161-30373183 AGCCACCGCGCCGAGCCAAGAGG - Intronic
1136579432 16:31142740-31142762 CGCGGCCCCAGCGGGCCAGGCGG + Exonic
1137617701 16:49856947-49856969 CGCCGCCGCCGCTGCCCAGGAGG - Intronic
1138265469 16:55656826-55656848 CGCCGTCGCGGGGCGCCAGCAGG - Exonic
1140927840 16:79600171-79600193 CGCCGGCTCGGCGCGCAAGGAGG - Exonic
1141582722 16:85011321-85011343 CGCCGCCGCCGCAGGCCGGGAGG - Exonic
1142067668 16:88072100-88072122 CGCCGCCGCGGGGTCCGAGGAGG - Exonic
1143321233 17:6070463-6070485 AGCAGCCCCGGGGAGCCAGGCGG + Intronic
1144828962 17:18121303-18121325 CCCGGCAGCGGCGAGCCGGGTGG - Exonic
1145765506 17:27456256-27456278 GGCGGCCGCGGCGAGGCAGGCGG - Intergenic
1147629012 17:41918331-41918353 CGCCTCCGGGGCGGGCCACGCGG - Intronic
1148262243 17:46193559-46193581 CGCCCCCGCGGGCCGCCAGGAGG + Intronic
1148772270 17:50074271-50074293 TGCTGCTGCGGTGAGCCAGGAGG + Exonic
1148909163 17:50931259-50931281 AGCGGCCGCAGCGAGCCAGGCGG - Intergenic
1148911242 17:50944315-50944337 CGCCTCCGCGCCAAGCCTGGGGG - Intergenic
1150168447 17:62966498-62966520 CGCCGCCGAGCCGAGCCGAGGGG + Intergenic
1150488785 17:65560925-65560947 CGACGCCGCGGCCGGCCCGGGGG - Intronic
1152649876 17:81487942-81487964 GGCCTCCGCGGCGAGGCATGGGG - Intergenic
1152697576 17:81804535-81804557 GGCCGCCGCAGGGCGCCAGGCGG - Intronic
1152745632 17:82037404-82037426 CTGCGAGGCGGCGAGCCAGGAGG - Intronic
1153688205 18:7567241-7567263 CGCCGCCGCGGCCCGCTAGAGGG - Exonic
1153805343 18:8705461-8705483 CGCGGCGGCGGCGAGCCCCGCGG + Intergenic
1157095103 18:44680207-44680229 CGCCGCCTCCGCGCGCCCGGGGG + Intronic
1159040539 18:63319916-63319938 CGCCGCCGCGCAGGACCAGGAGG - Exonic
1160960609 19:1719051-1719073 CGCCGCCGCAGCGGGGCTGGGGG + Intergenic
1161511873 19:4676498-4676520 AGCCTCCGCGGGGAACCAGGCGG - Exonic
1161955044 19:7489035-7489057 CGTCGGCGCGCCGCGCCAGGGGG + Intronic
1163635104 19:18433914-18433936 CGTGACCGCGGCGGGCCAGGTGG + Intronic
1167249204 19:48391641-48391663 CGCCGCCACGGCAAAGCAGGAGG - Intergenic
1167416120 19:49373752-49373774 AGCCACCGCGTCCAGCCAGGAGG + Intronic
928094146 2:28393656-28393678 CGCGGCCGCGGCGAGGGCGGGGG + Exonic
928606110 2:32946759-32946781 CTCCGCCTCGGCGACCCACGGGG + Intergenic
929075244 2:38075181-38075203 CGCGGCGGCGGTGGGCCAGGCGG - Exonic
934079017 2:88452164-88452186 CGCGGGCGCGGCGGGCGAGGCGG + Exonic
935746507 2:106194081-106194103 CGGCGCCGCGGTGGGCCGGGCGG - Intronic
943369967 2:187003444-187003466 TGCTGCCGCTGCGAGCCGGGCGG + Intergenic
947641155 2:231708573-231708595 GGCGGCTGCGGCGAGCAAGGAGG - Exonic
948910263 2:240999131-240999153 CGCCGCCGCCGCCAGCCACTTGG + Intronic
948983735 2:241508105-241508127 CGCCGCAGGGGCGAGCTAGCCGG - Exonic
949049755 2:241891066-241891088 GGCCTCCTCGGCGAGGCAGGTGG + Intergenic
1169664534 20:8019548-8019570 CGCCACAGCCGCGATCCAGGCGG + Exonic
1172939800 20:38646328-38646350 CGCCGTCACGGGGAGCGAGGAGG + Intronic
1173228732 20:41177740-41177762 CGCAGGAGCGGCCAGCCAGGGGG - Intronic
1173251643 20:41366782-41366804 AGCCGCCGCGAAGCGCCAGGCGG - Exonic
1174506790 20:51022572-51022594 CGCCGCCGCGGTGACCCCGGCGG - Intronic
1177157358 21:17513026-17513048 CGCCGCCGCCGCGAGCCAGTCGG + Exonic
1178948415 21:36966722-36966744 CGCCGCCCCCCCGGGCCAGGCGG + Intronic
1182319667 22:29470425-29470447 CGACGCCGCGGCGGCCAAGGCGG + Intergenic
1182350245 22:29695362-29695384 CGCCGCCTCGGGGTGCCTGGCGG - Exonic
1184337544 22:43862567-43862589 CGCCGCGGCCGCGTGCCGGGCGG - Intergenic
950548111 3:13650756-13650778 CCCGGCCGGGGCGAGGCAGGTGG + Intergenic
956229597 3:66998576-66998598 CGCCGGCGCTGCGCCCCAGGAGG + Intronic
958814502 3:98901311-98901333 CGCCGCGATGGCGAGCCGGGCGG - Exonic
961735856 3:129001820-129001842 CGGCGCCGCGGCAGTCCAGGTGG - Exonic
963904469 3:150762691-150762713 CGCCGCCGCGGCGGGCACCGCGG + Exonic
966748812 3:183302907-183302929 AGCCACCGCGCCCAGCCAGGAGG - Intronic
966915830 3:184583718-184583740 CGCCGCCGCAGCCGGCCCGGGGG + Intronic
967858255 3:194134272-194134294 CGCCGCCGCCGGGTGCCACGTGG - Intergenic
967904101 3:194486792-194486814 CGCCGCCGCCGCGGGCGCGGAGG - Intronic
968173464 3:196528875-196528897 CGCCTCCGCGGGGAGCTGGGCGG + Intergenic
968258191 3:197298001-197298023 GGGGGCCGCGGCGAGCGAGGAGG - Intronic
968341389 3:197958919-197958941 AGCCACCGCGCCCAGCCAGGAGG - Intronic
968574454 4:1358621-1358643 AGCGGCCGCGCGGAGCCAGGAGG - Intronic
968642493 4:1721587-1721609 CGCCGCCGCCGCCAGGAAGGAGG - Exonic
968729140 4:2261589-2261611 CGCCCCGGCGGCCAGCCTGGAGG - Intronic
968965153 4:3765952-3765974 CGCAGCTCCGGCGAGCGAGGCGG + Intergenic
971457933 4:26861322-26861344 GGCCGCCGCGGCGGGAGAGGAGG - Exonic
980013599 4:127623289-127623311 GGCCGCCGCGGTGAACCTGGAGG - Intronic
984966365 4:185143512-185143534 CGCGGGCGCGGCGGGCCGGGCGG + Intronic
986608252 5:9544806-9544828 GGCCGCCGCGGGGAGCGAGCCGG + Intronic
987050470 5:14143766-14143788 GGCCGCCGCGGCGGGGCCGGAGG - Exonic
990382993 5:55233757-55233779 CGCCTCCGCGGCCCGCCGGGGGG + Intergenic
991587353 5:68215083-68215105 CGCCGCCTCCGGGAGCCAGGCGG - Intergenic
991676529 5:69094189-69094211 CGCGGCAGCGGCGAGACATGAGG + Exonic
996055061 5:118973662-118973684 GGCGGCTGCGGCGAGCAAGGAGG - Intronic
997302088 5:132813651-132813673 GGCTGCCGGGGTGAGCCAGGCGG + Exonic
999315660 5:150582404-150582426 CGCGGCAGCGGCGGGCCTGGTGG + Intergenic
1001381712 5:171310132-171310154 CGCCGCTGCGGAGACACAGGAGG - Exonic
1002784988 6:393440-393462 CGCCTCCGAGGCGAGCCCAGGGG + Intronic
1002887848 6:1312102-1312124 CGCAGCCGCGGCAGGCCAGCGGG + Intergenic
1002926552 6:1608985-1609007 CGGCGGCGCGGCGAGCCGGTGGG + Intergenic
1005464976 6:26104055-26104077 CGCCACCGCGCCGAGCCAAACGG - Exonic
1005473925 6:26188947-26188969 CGCCGCCGCGGCGAGCCAGGCGG + Exonic
1005940529 6:30556471-30556493 CGCCCCGGCGGCGAGGAAGGAGG + Exonic
1006472654 6:34237327-34237349 CGCCGCCGCCGCGGGCCCCGGGG - Intronic
1007927748 6:45663563-45663585 CGCCGCTGCGGCGAGCTTGGAGG + Intronic
1015149345 6:130020222-130020244 CGCCGCGGCGGCGGGGCGGGGGG + Intronic
1019198366 6:170295625-170295647 CGCAGCCGCGGCCAGCGGGGAGG - Intronic
1020418120 7:7969158-7969180 CGCCGCCTCGGCGAGGGGGGAGG - Exonic
1024963804 7:55004605-55004627 CGCGGCCGCGGGGAGCAGGGCGG + Intergenic
1026577416 7:71583837-71583859 AGCCACCGCGCCCAGCCAGGAGG - Intronic
1026720601 7:72827919-72827941 AGCCGCCGCTGAGAGCAAGGAGG - Intronic
1027177723 7:75915267-75915289 CCCCGACGCAGAGAGCCAGGCGG - Intronic
1034578846 7:152025636-152025658 CGCCGGCGCCGCGTGACAGGCGG - Intergenic
1036286529 8:7448228-7448250 CACCGCAGGGGAGAGCCAGGGGG - Intronic
1036334948 8:7863300-7863322 CACCGCAGGGGAGAGCCAGGGGG + Intronic
1036432169 8:8701862-8701884 CGCCGCCCCGCCGGGCCAGGCGG - Intergenic
1038632943 8:29262944-29262966 CTCCGCCCCGGCGGCCCAGGAGG + Intronic
1045663936 8:104466550-104466572 CGGCGCCGCGCCGCGCGAGGCGG + Intronic
1046097079 8:109575103-109575125 CGACGCCCCCGCGAGCCAGTGGG + Exonic
1049788486 8:144462529-144462551 CGCCGCCGCCGCCTGCCCGGCGG + Intronic
1049910115 9:257800-257822 AGCCACCGCGCCCAGCCAGGAGG + Intronic
1051659562 9:19413311-19413333 AGCCACCGCGCCCAGCCAGGGGG - Intronic
1053434903 9:38068278-38068300 GGCGGCAGCGGGGAGCCAGGCGG - Exonic
1053434998 9:38068686-38068708 CGCCGCCGCGGCCATTCGGGGGG + Exonic
1057773157 9:97984458-97984480 CGCCGCCGCCGCGGCACAGGGGG - Intronic
1057921973 9:99105107-99105129 CGCCGCGGCGGCTAGGGAGGTGG + Exonic
1059208380 9:112487155-112487177 CGCCGACGCCGCGACCCAGGCGG + Exonic
1060087411 9:120714704-120714726 CGGGGCCGCCGCGAGCCCGGCGG - Intergenic
1061490142 9:130939918-130939940 CGCCGCCCCGCCGAGCCCGCCGG + Intergenic
1061540735 9:131276915-131276937 GGCGGCCGCGGCGAAGCAGGCGG - Intergenic
1187915400 X:24149320-24149342 CGACCCCGCGGAGAGGCAGGCGG - Intronic
1187915464 X:24149526-24149548 CGCCGACACGGGGTGCCAGGAGG + Intronic
1188003523 X:25002639-25002661 CGCCGCCGCCGCCGGCCAGTCGG - Intergenic
1200163320 X:154019970-154019992 CGCGGCCGCGGCGCGCAAGATGG - Exonic