ID: 1005473927

View in Genome Browser
Species Human (GRCh38)
Location 6:26188950-26188972
Sequence CGCCGCGGCGAGCCAGGCGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 756
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 726}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005473922_1005473927 -4 Left 1005473922 6:26188931-26188953 CCAGAAATACGCTTGACGCCGCC 0: 1
1: 0
2: 4
3: 7
4: 15
Right 1005473927 6:26188950-26188972 CGCCGCGGCGAGCCAGGCGGCGG 0: 1
1: 0
2: 3
3: 26
4: 726
1005473919_1005473927 20 Left 1005473919 6:26188907-26188929 CCGCGAGTTTCCTCATAAATGAG 0: 1
1: 0
2: 1
3: 15
4: 99
Right 1005473927 6:26188950-26188972 CGCCGCGGCGAGCCAGGCGGCGG 0: 1
1: 0
2: 3
3: 26
4: 726
1005473921_1005473927 10 Left 1005473921 6:26188917-26188939 CCTCATAAATGAGGCCAGAAATA 0: 1
1: 0
2: 3
3: 28
4: 292
Right 1005473927 6:26188950-26188972 CGCCGCGGCGAGCCAGGCGGCGG 0: 1
1: 0
2: 3
3: 26
4: 726

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005473927 Original CRISPR CGCCGCGGCGAGCCAGGCGG CGG Exonic
900139163 1:1132279-1132301 CGCCGCCGCGAGCCCTGCGTTGG + Intergenic
900349611 1:2228333-2228355 CGCCGCGGCGGCCGAGGCCGAGG - Intergenic
900349742 1:2228683-2228705 CGCCGGGGCGCGCGGGGCGGCGG + Exonic
900418747 1:2546608-2546630 GTCCCCGGCGAGCCTGGCGGGGG + Intergenic
900651689 1:3732960-3732982 AACCGCGGCGGCCCAGGCGGCGG + Exonic
901030644 1:6305225-6305247 CGGGGCGGCGGGCCGGGCGGGGG + Intronic
901341595 1:8501772-8501794 CGGGGCGGCTGGCCAGGCGGGGG - Intronic
901341722 1:8502048-8502070 CGGGGCGGCTGGCCAGGCGGGGG - Intronic
901793092 1:11664571-11664593 CCCCGGGGCCACCCAGGCGGAGG + Intronic
902044276 1:13513558-13513580 CGCCGCGGCGGCGCAGGCTGGGG + Exonic
902600890 1:17539694-17539716 CGCCGCGTCGCGCACGGCGGCGG + Intergenic
903081511 1:20815937-20815959 CGGGGCGGCTGGCCAGGCGGGGG - Intronic
903508215 1:23853403-23853425 CGGGGCGGCTGGCCAGGCGGGGG - Intronic
903525111 1:23987285-23987307 CGGGGCGGCTGGCCAGGCGGGGG + Intergenic
903637818 1:24833636-24833658 CGGGGCGGCTGGCCAGGCGGGGG + Intronic
903923608 1:26818082-26818104 CGGCACGGCTGGCCAGGCGGGGG - Intergenic
903923709 1:26818308-26818330 CGGGGCGGCTGGCCAGGCGGGGG - Intergenic
904077485 1:27853257-27853279 CGGGGCGGCTGGCCAGGCGGGGG - Intergenic
904784481 1:32974372-32974394 CGGGGCGGCTGGCCAGGCGGGGG + Intergenic
904784534 1:32974499-32974521 CGGGGCGGCTGGCCAGGCGGGGG + Intergenic
904784634 1:32974722-32974744 CGGGGCGGCTGGCCAGGCGGGGG + Intergenic
904795029 1:33052000-33052022 CGGCACGGCTGGCCAGGCGGGGG - Intronic
904795128 1:33052225-33052247 CGGGGCGGCTGGCCAGGCGGGGG - Intronic
904831606 1:33309418-33309440 CGGGGCGGCTGGCCAGGCGGGGG + Intronic
906427397 1:45725223-45725245 CGGGGCGGCTGGCCAGGCGGGGG - Intronic
906486962 1:46241386-46241408 CGGGGCGGCTGGCCAGGCGGGGG - Intergenic
906761582 1:48382784-48382806 CGGGGCGGCTGGCCAGGCGGGGG + Intronic
907453646 1:54562244-54562266 CGGGGCGGCTGGCCAGGCGGGGG + Intronic
907453744 1:54562469-54562491 CGGCACGGCTGGCCAGGCGGGGG + Intronic
908293153 1:62688093-62688115 CCCCGCCGCGAGCCAGGCCGCGG + Intronic
909640947 1:77869841-77869863 CGGGGCGGCTGGCCAGGCGGGGG + Intronic
910343944 1:86216300-86216322 CGGGGCGGCTGGCCAGGCGGGGG - Intergenic
911133805 1:94418333-94418355 CGGCGGCGCGAGCCAGGGGGCGG + Intergenic
912298439 1:108489806-108489828 CGGCACGGCTGGCCAGGCGGGGG + Intergenic
912690271 1:111799930-111799952 CGGGGCGGCTGGCCAGGCGGGGG - Intronic
912751817 1:112293647-112293669 CGGGGCGGCTGGCCAGGCGGGGG - Intergenic
912752136 1:112294365-112294387 CGGGGCGGCTGGCCAGGCGGGGG - Intergenic
912808027 1:112773591-112773613 CGGGGCGGCTGGCCAGGCGGGGG - Intergenic
912825197 1:112898456-112898478 CGGGGCGGCTGGCCAGGCGGGGG + Intergenic
912825221 1:112898505-112898527 CGGGGCGGCTGGCCAGGCGGGGG + Intergenic
912825274 1:112898632-112898654 CGGGGCGGCTGGCCAGGCGGGGG + Intergenic
912844963 1:113069700-113069722 CGGGGCGGCTGGCCAGGCGGGGG - Intergenic
912879191 1:113391175-113391197 CTCCGCGAGGAGCCCGGCGGGGG + Exonic
913306153 1:117430234-117430256 CGGCACGGCTGGCCAGGCGGGGG + Intronic
913651124 1:120914071-120914093 CGCTGCCGCGAGCCCGGCTGGGG + Intergenic
913993886 1:143638140-143638162 CGGGGCGGCTGGCCAGGCGGGGG - Intergenic
913994164 1:143638766-143638788 CGGGGCGGCTGGCCAGGCGGGGG - Intergenic
914169988 1:145214996-145215018 CGCTGCCGCGAGCCCGGCTGGGG - Intergenic
914525105 1:148458959-148458981 CGCTGCCGCGAGCCCGGCTGGGG - Intergenic
914641298 1:149608175-149608197 CGCTGCCGCGAGCCCGGCTGGGG + Intergenic
914775108 1:150728781-150728803 CGGGGCGGCTGGCCAGGCGGGGG + Intergenic
916087406 1:161281446-161281468 CGGGGCGGCTGGCCAGGCGGAGG + Intronic
917848281 1:179040465-179040487 CGAGGCGGCTAGCCGGGCGGGGG + Intronic
918228605 1:182509467-182509489 CGGGGCGGCTGGCCAGGCGGGGG + Intronic
919925796 1:202191429-202191451 CGGGGCGGCTGGCCAGGCGGGGG + Intergenic
920152455 1:203919871-203919893 CGGGGCGGCTGGCCAGGCGGGGG + Intergenic
920195302 1:204222635-204222657 TGCCGCAGGGAGCCAGGCTGGGG - Exonic
921140196 1:212298855-212298877 CGGGGCGGCTGGCCAGGCGGGGG + Intronic
921189822 1:212699602-212699624 CGCCGCGGGGGGCGAGGAGGTGG - Intronic
921414259 1:214869786-214869808 CGGCACGGCTGGCCAGGCGGGGG + Intergenic
922278568 1:224101106-224101128 CGGGGCGGCTGGCCAGGCGGGGG - Intergenic
923710952 1:236387109-236387131 CGGGGCGGCTGGCCAGGCGGGGG - Intronic
1064108503 10:12519770-12519792 CGGGGCGGCTGGCCAGGCGGGGG + Intronic
1065055404 10:21837835-21837857 CGGGGCGGCTGGCCAGGCGGGGG - Intronic
1066085488 10:31970250-31970272 CGGGGCGGCTGGCCAGGCGGGGG - Intergenic
1066994603 10:42552372-42552394 CGCAGAGGCGAGCGAGGTGGCGG - Intergenic
1067060654 10:43076568-43076590 CTCCGCGGAGAGCCTGGAGGCGG + Intergenic
1067071876 10:43138453-43138475 CGCGGCGGCGCGCCCGGGGGTGG + Intergenic
1068536227 10:58243967-58243989 CGGGGCGGCGCGCCAGGCAGAGG - Intronic
1068969850 10:62948355-62948377 CGGGGCGGCTGGCCAGGCGGGGG - Intergenic
1069034195 10:63630438-63630460 CGCCGGGGAGAGGGAGGCGGCGG + Intergenic
1069365682 10:67691773-67691795 CGGGGCGGCTGGCCAGGCGGGGG - Intronic
1069699083 10:70408133-70408155 CGGGGCGGCTGGCCAGGCGGGGG + Intronic
1069741284 10:70687663-70687685 CGGGGCGGCTGGCCAGGCGGGGG + Intronic
1069929980 10:71875752-71875774 CGGGGCGGCTGGCCAGGCGGGGG + Intergenic
1070318007 10:75333435-75333457 CGGGGCGGCTGGCCAGGCGGGGG + Intergenic
1070318081 10:75333611-75333633 CGGCACGGCTGGCCAGGCGGGGG + Intergenic
1070318103 10:75333660-75333682 CGGCACGGCTGGCCAGGCGGGGG + Intergenic
1070789065 10:79178929-79178951 AGCAGCGCTGAGCCAGGCGGGGG - Intronic
1071086633 10:81874549-81874571 CGCCGCCGCGAGCCAGGGGCTGG - Intergenic
1072059744 10:91798479-91798501 CGCCGCCGCGGGGCAGCCGGGGG + Exonic
1072149875 10:92675115-92675137 CGGGGCGGCTGGCCAGGCGGGGG + Intergenic
1072149973 10:92675341-92675363 CGGCACGGCTGGCCAGGCGGGGG + Intergenic
1072602255 10:96941263-96941285 CGGGGCGGCTGGCCAGGCGGGGG + Intronic
1072648360 10:97275941-97275963 CGGGGCGGCTGGCCAGGCGGGGG - Intronic
1072648463 10:97276167-97276189 CGGGGCGGCTGGCCAGGCGGGGG - Intronic
1072999959 10:100277894-100277916 CGGGGCGGCTGGCCAGGCGGGGG - Intronic
1073325570 10:102642667-102642689 CGCCGCCGCGAGGAAGGCGGCGG - Intergenic
1074008942 10:109457049-109457071 GGCCGCGGCGGGGCAGGCGTAGG + Intergenic
1075136925 10:119794673-119794695 CGGGGCGGCTGGCCAGGCGGGGG + Intronic
1075401411 10:122163831-122163853 AGCCGGGGCGAGCCGGCCGGCGG - Intronic
1076342899 10:129761782-129761804 TGCCGAGGGCAGCCAGGCGGTGG + Intronic
1077476242 11:2791786-2791808 CGCCGCGCCGCTCCGGGCGGTGG + Intronic
1077668488 11:4137375-4137397 CGGGGCGGCTGGCCAGGCGGGGG + Intronic
1078177022 11:8978511-8978533 CGGGGCGGCTGGCCAGGCGGGGG - Intergenic
1078177148 11:8978786-8978808 CGGGGCGGCTGGCCAGGCGGGGG - Intergenic
1079039814 11:17050564-17050586 CGGCACGGCTGGCCAGGCGGGGG + Intergenic
1079173960 11:18121338-18121360 CGGGGCGGCTGGCCAGGCGGGGG - Intronic
1079371980 11:19860146-19860168 CGGGGCGGCTGGCCAGGCGGGGG + Intronic
1080098111 11:28430561-28430583 CGGGGCGGCTGGCCAGGCGGGGG - Intergenic
1080098184 11:28430737-28430759 CGGGGCGGCTGGCCAGGCGGAGG - Intergenic
1081288781 11:41304184-41304206 CGGGGCGGCTGGCCAGGCGGGGG - Intronic
1081784768 11:45738537-45738559 CGGCACGGCTGGCCAGGCGGGGG + Intergenic
1081956292 11:47097112-47097134 CGGGGCGGCTGGCCAGGCGGGGG - Intronic
1083265760 11:61546203-61546225 CGCCGCGGCGGGGCTGGCGGTGG - Exonic
1083303739 11:61752507-61752529 CGCCGCGCCCAGCCCGGCCGCGG - Intergenic
1083333964 11:61912241-61912263 CGCCCCGGGGAGCCAGGCCCTGG - Intronic
1083382455 11:62279118-62279140 CGGGGCGGCTGGCCAGGCGGGGG - Intergenic
1083646004 11:64172178-64172200 CGGGGCGGCTGGCCAGGCGGGGG + Intergenic
1083659804 11:64246780-64246802 CTCCGCGGCGAGGGCGGCGGCGG + Exonic
1083739677 11:64702015-64702037 CGGGGCGGCTGGCCAGGCGGGGG - Intronic
1083865753 11:65451860-65451882 CGGGGCGGCTGGCCAGGCGGGGG - Intergenic
1084084593 11:66849197-66849219 CCCCAGGGCCAGCCAGGCGGTGG - Intronic
1085292426 11:75410044-75410066 CGGGGCGGCTGGCCAGGCGGGGG + Intronic
1085513198 11:77098479-77098501 CGGGGCGGCTGGCCAGGCGGAGG + Intronic
1085513295 11:77098704-77098726 CGGGGCGGCTGGCCAGGCGGAGG + Intronic
1086104515 11:83133520-83133542 CGGGGCGGCTGGCCAGGCGGGGG - Intergenic
1086792871 11:91063748-91063770 CGGGGCGGCTGGCCAGGCGGGGG - Intergenic
1087057233 11:93947095-93947117 CGGGGCGGCTGGCCAGGCGGGGG + Intergenic
1087948739 11:104194888-104194910 CGGGGCGGCTGGCCAGGCGGGGG - Intergenic
1089421042 11:118331739-118331761 CGGCGCGGCTGGCCGGGCGGGGG + Intergenic
1089510108 11:118991599-118991621 CGGGGCGGCTGGCCAGGCGGGGG + Intergenic
1089580891 11:119481522-119481544 CGCCGCGGTCGGCCAGGAGGTGG + Intergenic
1089585539 11:119507823-119507845 CGGGGCGGCTGGCCAGGCGGGGG + Intergenic
1090791102 11:130091745-130091767 CGGCACGGCTGGCCAGGCGGGGG + Intronic
1092295999 12:7199999-7200021 CGGGGCGGCTGGCCAGGCGGGGG + Intronic
1092453750 12:8625629-8625651 CGGGGCGGCTGGCCAGGCGGGGG - Intergenic
1092453825 12:8625805-8625827 CGGGGCGGCTGGCCAGGCGGGGG - Intergenic
1092453927 12:8626031-8626053 CGGGGCGGCTGGCCAGGCGGGGG - Intergenic
1092462340 12:8697842-8697864 CGCCGCGGCGCGGCGGGCGGGGG - Intronic
1092591124 12:9953370-9953392 CGGGGCGGCTGGCCAGGCGGGGG - Intronic
1092591148 12:9953419-9953441 CGGGGCGGCTGGCCAGGCGGGGG - Intronic
1092827450 12:12413812-12413834 CGGGGCGGCTGGCCAGGCGGGGG + Intronic
1092827552 12:12414036-12414058 CGGGGCGGCTGGCCAGGCGGGGG + Intronic
1092827676 12:12414311-12414333 CGGGGCGGCTGGCCAGGCGGGGG + Intronic
1093927842 12:24926344-24926366 CGGGGCGGCTGGCCAGGCGGGGG - Intronic
1094103513 12:26785715-26785737 CGGGGCGGCTGGCCAGGCGGGGG - Intronic
1094573085 12:31659210-31659232 CGCCGCGGCCCGGCAGGGGGCGG - Intronic
1095068665 12:37814717-37814739 CGGGGCGGCTGGCCAGGCGGTGG + Intergenic
1095439521 12:42227808-42227830 CGGCACGGCTGGCCAGGCGGGGG - Intronic
1095439595 12:42227984-42228006 CGGGGCGGCTGGCCAGGCGGGGG - Intronic
1095439796 12:42228438-42228460 CGGGGCGGCTGGCCAGGCGGGGG - Intronic
1095439826 12:42228493-42228515 CGGGGCGGCTGGCCAGGCGGGGG - Intronic
1096022288 12:48333119-48333141 CGGCACGGCTGGCCAGGCGGGGG + Intergenic
1096713368 12:53474979-53475001 CGCTGTGGCGAGCGAGGGGGTGG - Intronic
1097126863 12:56783292-56783314 CGGGGCGGCTGGCCAGGCGGGGG + Intronic
1097127817 12:56789107-56789129 CGGGGCGGCTGGCCAGGCGGGGG + Intergenic
1097155092 12:57006520-57006542 CGTCGCGGCGAGCCGCGCGGCGG - Intergenic
1098412938 12:70202676-70202698 CGGGGCGGCTGGCCAGGCGGGGG - Intergenic
1099202018 12:79689713-79689735 CGCAGAGGTGAGCCGGGCGGGGG - Exonic
1100570600 12:95841196-95841218 CGGGGCGGCTGGCCAGGCGGGGG + Intergenic
1100577582 12:95907556-95907578 CGAGGCGGCTGGCCAGGCGGGGG + Intronic
1100582166 12:95947775-95947797 CGGGGCGGCTGGCCAGGCGGGGG - Intronic
1102293877 12:111723120-111723142 CGGGGCGGCTAGCCGGGCGGGGG + Intronic
1105248530 13:18674095-18674117 CGGGGCGGCTGGCCAGGCGGGGG - Intergenic
1105526943 13:21186322-21186344 CGGGGCGGCTGGCCAGGCGGGGG + Intergenic
1106114598 13:26806320-26806342 CGGGGCGGCTGGCCAGGCGGGGG + Intergenic
1106269360 13:28138707-28138729 CGCCGCCGCCAGCGAGGAGGAGG - Exonic
1106517144 13:30465324-30465346 CGCCGCAGCGAGCCGGGCGCTGG - Intronic
1106560154 13:30839706-30839728 TGGGGCGGCTAGCCAGGCGGGGG + Intergenic
1107851472 13:44576728-44576750 CGCGGCTGCGAGCGGGGCGGCGG + Intronic
1108608846 13:52064510-52064532 CGGGGCGGCTGGCCAGGCGGGGG - Intronic
1110269488 13:73575190-73575212 CGGGGCGGCTGGCCAGGCGGGGG - Intergenic
1114199409 14:20506825-20506847 CGGGGCGGCTGGCCAGGCGGGGG - Intronic
1114427898 14:22637745-22637767 CGGGGCGGCTGGCCAGGCGGGGG - Intergenic
1115609746 14:35039190-35039212 CGGCACGGCTGGCCAGGCGGGGG - Intergenic
1115609768 14:35039239-35039261 CGGGGCGGCTAGCCGGGCGGGGG - Intergenic
1115703325 14:35976876-35976898 CGGGGCGGCTGGCCAGGCGGGGG + Intergenic
1116480427 14:45389380-45389402 CGGCACGGCTGGCCAGGCGGGGG - Intergenic
1116480526 14:45389606-45389628 CGGGGCGGCTGGCCAGGCGGGGG - Intergenic
1118341096 14:64895502-64895524 CGGGGCGGCTGGCCAGGCGGGGG + Intergenic
1118428398 14:65692207-65692229 CGGGGCGGCTGGCCAGGCGGGGG + Intronic
1118584741 14:67341525-67341547 CGGGGCGGCTGGCCAGGCGGGGG - Intronic
1119254236 14:73184030-73184052 CGGGGCGGCTGGCCAGGCGGGGG + Intronic
1119594850 14:75924938-75924960 CGGGGCGGCTGGCCAGGCGGAGG + Intronic
1119725535 14:76919950-76919972 GGCAGCGGCGTGGCAGGCGGCGG + Intergenic
1120881346 14:89417158-89417180 CGCCGCGGCGCGTCGGGCCGGGG + Intronic
1121190643 14:92026466-92026488 GGCTGCGGCGAGCAAGGAGGCGG - Intronic
1121306733 14:92911720-92911742 CGGCACGGCTGGCCAGGCGGGGG + Intergenic
1122963613 14:105111564-105111586 CGGGGCGGCTGGCCAGGCGGGGG + Intergenic
1122963766 14:105111917-105111939 CGGGGCGGCTGGCCAGGCGGGGG + Intergenic
1122963789 14:105111966-105111988 CGGGGCGGCTGGCCAGGCGGGGG + Intergenic
1124245931 15:28070502-28070524 CGGGGCGGCTGGCCAGGCGGGGG - Intronic
1124335005 15:28849670-28849692 CGGGGCGGCTGGCCAGGCGGGGG + Intergenic
1124966726 15:34437425-34437447 CGGCGCGGCGAGGACGGCGGCGG - Intronic
1125016887 15:34946542-34946564 CGGGGCGGCTGGCCAGGCGGGGG - Intronic
1125429502 15:39581066-39581088 CGCAGCGGCTGGCAAGGCGGAGG - Intronic
1125459380 15:39893758-39893780 CGGGGCGGCTGGCCAGGCGGGGG + Intronic
1125459508 15:39894062-39894084 CGGGGCGGCTGGCCAGGCGGGGG + Intronic
1125459532 15:39894111-39894133 CGGGGCGGCTGGCCAGGCGGGGG + Intronic
1125659216 15:41382617-41382639 CGGCACGGCTGGCCAGGCGGGGG - Intergenic
1125659316 15:41382843-41382865 CGGGGCGGCTGGCCAGGCGGGGG - Intergenic
1125805596 15:42491009-42491031 GGCCGCCGAGAGCCAGGCGAGGG + Intronic
1126295645 15:47133171-47133193 CGGGGCGGCTGGCCAGGCGGGGG - Intergenic
1126766999 15:52019431-52019453 CGCCGCGGCGGGCCCGGCGGCGG + Intronic
1127071185 15:55289709-55289731 CGGCGGGGCGAGCCAGGTGAGGG - Intronic
1127072990 15:55303095-55303117 CGGCACGGCTGGCCAGGCGGGGG - Intronic
1127073065 15:55303271-55303293 CGGGGCGGCTGGCCAGGCGGGGG - Intronic
1127154217 15:56110152-56110174 CGGGGCGGCTGGCCAGGCGGGGG - Intronic
1127154270 15:56110281-56110303 CGGGGCGGCTGGCCAGGCGGGGG - Intronic
1127154297 15:56110333-56110355 CGAGGCGGCTGGCCAGGCGGGGG - Intronic
1128232950 15:66048232-66048254 CACCGCGCCCAGCCAGGAGGAGG + Intronic
1128752852 15:70161384-70161406 CGACGCAGCGAGGCAGGTGGGGG + Intergenic
1128843687 15:70871557-70871579 CGGCGCGGCTGGCCGGGCGGGGG + Intronic
1128970213 15:72100932-72100954 CGCGGCGGCTGGCCGGGCGGGGG - Intronic
1128970236 15:72100981-72101003 CGGGGCGGCTGGCCAGGCGGGGG - Intronic
1129341361 15:74888582-74888604 CGGGGCGGCTGGCCAGGCGGGGG + Intergenic
1129428471 15:75481450-75481472 CGGCACGGCTGGCCAGGCGGGGG - Intronic
1129431815 15:75504811-75504833 CGGGGCGGCTGGCCAGGCGGGGG - Intronic
1130335333 15:82952823-82952845 CGCGGCAGCGAGCCAAGAGGCGG + Intronic
1130340681 15:82997987-82998009 CGGGGCGGCTGGCCAGGCGGGGG + Intronic
1130340770 15:82998194-82998216 CGGCACGGCTGGCCAGGCGGGGG + Intronic
1131125393 15:89854356-89854378 CGGGGCGGCTGGCCAGGCGGGGG - Intronic
1132586021 16:706035-706057 GCCCGCGGCGAGCGGGGCGGGGG - Intronic
1132776796 16:1599384-1599406 CGGCACGGCTGGCCAGGCGGGGG - Intronic
1132776818 16:1599433-1599455 CGGCACGGCTGGCCAGGCGGGGG - Intronic
1132885067 16:2178939-2178961 GGCCGCGGCGCTGCAGGCGGTGG - Exonic
1133364818 16:5202479-5202501 CGGGGCGGCTGGCCAGGCGGGGG + Intergenic
1134208871 16:12259489-12259511 AGCTGCGGGGAGCCAGGTGGGGG - Intronic
1136365480 16:29807240-29807262 CGCCGCGGCGATAGTGGCGGCGG - Exonic
1136572443 16:31105169-31105191 CGGGGCGGCTGGCCAGGCGGGGG - Intergenic
1136572544 16:31105395-31105417 CGGGGCGGCTGGCCAGGCGGGGG - Intergenic
1136593576 16:31232407-31232429 CGGGGCGGCTGGCCAGGCGGGGG - Intergenic
1136593753 16:31232808-31232830 CGGGGCGGCTGGCCAGGCGGGGG - Intergenic
1138106845 16:54291556-54291578 AGCCGTCGCGAGCCAGCCGGGGG - Intergenic
1138400427 16:56739874-56739896 CGGGGCGGCTGGCCAGGCGGGGG + Intronic
1138400529 16:56740100-56740122 CGGGGCGGCTGGCCAGGCGGGGG + Intronic
1138450726 16:57092408-57092430 TGCCGCGGCGCGCCGGGCGCGGG + Intergenic
1139774985 16:69311409-69311431 CGGCGCGGGAAGCCCGGCGGTGG - Exonic
1139864461 16:70051741-70051763 CGGGGCGGCTGGCCAGGCGGGGG - Intergenic
1139864515 16:70051868-70051890 CGGGGCGGCTGGCCAGGCGGGGG - Intergenic
1139864590 16:70052044-70052066 CGGGGCGGCTGGCCAGGCGGGGG - Intergenic
1139890589 16:70251259-70251281 CGCCACGGTGAGGCCGGCGGCGG + Exonic
1142613717 17:1123426-1123448 AGCCCCGGAGCGCCAGGCGGGGG + Intronic
1142818815 17:2447962-2447984 CGGGGCGGCTGGCCAGGCGGGGG - Intronic
1142825347 17:2507085-2507107 CGGGGCGGCTGGCCAGGCGGGGG - Intronic
1143321234 17:6070466-6070488 AGCCCCGGGGAGCCAGGCGGCGG + Intronic
1143390450 17:6556512-6556534 AGCCGAGGCGAGCGGGGCGGGGG - Intergenic
1144481987 17:15637182-15637204 CGGCACGGCTGGCCAGGCGGGGG - Intronic
1144524586 17:15979594-15979616 CGAGGCGGCTGGCCAGGCGGGGG + Intronic
1144763841 17:17722477-17722499 CGGCGCGTGGAGCCTGGCGGAGG - Intronic
1145205967 17:20984905-20984927 CGGGGCGGCTGGCCAGGCGGGGG - Intergenic
1145863013 17:28224341-28224363 CGGGGCGGCTGGCCAGGCGGGGG - Intergenic
1146216028 17:30979637-30979659 CGGGGCGGCTGGCCAGGCGGGGG + Intronic
1146216183 17:30979962-30979984 CGGGGCGGCTGGCCAGGCGGGGG + Intronic
1146444186 17:32922308-32922330 CGGGGCGGCTGGCCAGGCGGGGG + Intergenic
1146444311 17:32922583-32922605 CGGGGCGGCTGGCCAGGCGGGGG + Intergenic
1147963382 17:44180664-44180686 CGGCACGGCTGGCCAGGCGGGGG - Intergenic
1147963480 17:44180890-44180912 CGGGGCGGCTGGCCAGGCGGGGG - Intergenic
1147974421 17:44238780-44238802 CGGGGCGGCTGGCCAGGCGGGGG - Intergenic
1148493438 17:48037711-48037733 GGCCGCGGCGGCCCAGGCCGGGG - Exonic
1148807918 17:50273462-50273484 CGCCCCGGCGGGCCTGGCAGAGG + Intronic
1148867253 17:50635044-50635066 CCCCGCGGGAAGGCAGGCGGCGG - Intronic
1149593005 17:57846215-57846237 CGGGGCGGCTGGCCAGGCGGGGG - Intronic
1149624978 17:58074139-58074161 CGGGGCGGCTGGCCAGGCGGGGG + Intergenic
1149658615 17:58323235-58323257 CACCCCGGCCAGCCAGGTGGTGG - Intronic
1149780585 17:59394119-59394141 CGCGGCAGCTGGCCAGGCGGGGG + Intronic
1149908913 17:60551485-60551507 CGGCACGGCTGGCCAGGCGGGGG - Intergenic
1149908935 17:60551534-60551556 CGGCACGGCTGGCCAGGCGGGGG - Intergenic
1151623368 17:75261343-75261365 CGCCGCAGCGAGGGAAGCGGGGG + Intronic
1152020235 17:77776758-77776780 CGGGGCGGCTGGCCAGGCGGGGG - Intergenic
1152049087 17:77958773-77958795 CGCGGCGGCGGGGCCGGCGGCGG - Intergenic
1152069815 17:78128860-78128882 CGCCGCGGGGCGCCCGGAGGAGG - Intronic
1152649874 17:81487939-81487961 CTCCGCGGCGAGGCATGGGGAGG - Intergenic
1152660467 17:81539686-81539708 CGCAGGGGAGAGCCAGGCAGGGG + Intergenic
1152745629 17:82037401-82037423 CGAGGCGGCGAGCCAGGAGGGGG - Intronic
1153872707 18:9335011-9335033 GGCCGCGGCGAGCTTCGCGGGGG + Intronic
1155956646 18:31960799-31960821 CGGGGCGGCTAGCCGGGCGGGGG - Intergenic
1157639919 18:49203014-49203036 CGGCACGGCCGGCCAGGCGGGGG - Intronic
1157677203 18:49577672-49577694 CGGCACGGCTGGCCAGGCGGGGG + Intronic
1157677348 18:49577997-49578019 CGGCACGGCTGGCCAGGCGGGGG + Intronic
1160122797 18:76145675-76145697 CACCGCGGCGCCCCAGGCGCGGG - Intergenic
1160228411 18:77028725-77028747 CGGGGCGGCTGGCCAGGCGGGGG + Intronic
1160870443 19:1275416-1275438 CGCCGGGGCTCACCAGGCGGAGG + Exonic
1160935480 19:1592650-1592672 GGCGGCGGCGGGCCCGGCGGCGG - Exonic
1161080618 19:2308225-2308247 CTCCTCGGCGCGCCTGGCGGGGG + Intronic
1161215762 19:3094478-3094500 CCCGGCGGCTCGCCAGGCGGCGG + Exonic
1161685829 19:5702215-5702237 CGGGGCGGCTAGCCGGGCGGGGG - Intronic
1161829294 19:6590990-6591012 CGCCGCGGCGATGCCGGAGGAGG - Exonic
1161955045 19:7489038-7489060 CGGCGCGCCGCGCCAGGGGGCGG + Intronic
1162538167 19:11276690-11276712 CGGGGCGGCTGGCCAGGCGGGGG + Intergenic
1162602046 19:11676828-11676850 CGGGGCGGCTGGCCAGGCGGGGG + Intergenic
1162778649 19:12995601-12995623 GGCAGCGGCGAGCGCGGCGGCGG + Exonic
1162886899 19:13703461-13703483 CGGCACGGCTGGCCAGGCGGGGG - Intergenic
1162914059 19:13865154-13865176 CCCCGCGCCGCGCCGGGCGGTGG - Intronic
1162948539 19:14057545-14057567 CGAGGCAGCGAGCCCGGCGGGGG + Intronic
1163607095 19:18281485-18281507 CGGCGCGGCGGGGGAGGCGGAGG - Exonic
1163635107 19:18433917-18433939 GACCGCGGCGGGCCAGGTGGGGG + Intronic
1163714643 19:18866688-18866710 CGCCGCCGCGGGCCAGCAGGGGG - Exonic
1163905833 19:20149920-20149942 CGGGGCGGCTGGCCAGGCGGGGG + Intergenic
1164066593 19:21721524-21721546 CGGGGCGGCTGGCCAGGCGGGGG - Intergenic
1164081712 19:21865804-21865826 CGGGGCGGCTGGCCAGGCGGGGG + Intergenic
1164081736 19:21865853-21865875 CGGGGCGGCTGGCCAGGCGGGGG + Intergenic
1164105919 19:22107473-22107495 CGGGGCGGCTGGCCAGGCGGGGG + Intergenic
1164106020 19:22107699-22107721 CGGCACGGCTGGCCAGGCGGGGG + Intergenic
1164192194 19:22926385-22926407 CGGGGCGGCTGGCCAGGCGGGGG - Intergenic
1164659240 19:29948984-29949006 CGGGGCGGCTGGCCAGGCGGGGG + Intronic
1165192911 19:34079371-34079393 CGGGGCGGCTGGCCAGGCGGGGG + Intergenic
1165192933 19:34079420-34079442 CGGCACGGCTGGCCAGGCGGGGG + Intergenic
1165192979 19:34079519-34079541 CGGCACGGCTGGCCAGGCGGGGG + Intergenic
1166028466 19:40108514-40108536 CGGGGCGGCTGGCCAGGCGGGGG + Intergenic
1166029957 19:40118426-40118448 CGGGGCGGCTGGCCAGGCGGGGG - Intergenic
1166162781 19:40965842-40965864 CGGGGCGGCTGGCCAGGCGGGGG + Intergenic
1166162933 19:40966193-40966215 CGGGGCGGCTGGCCAGGCGGGGG + Intergenic
1166261609 19:41644840-41644862 CGGGGCGGCTGGCCAGGCGGGGG - Intronic
1166748329 19:45152474-45152496 CCCCACGCCGCGCCAGGCGGTGG - Exonic
1167970647 19:53186857-53186879 CGGGGCGGCTGGCCAGGCGGGGG + Intronic
1167970745 19:53187077-53187099 CGGGGCGGCTGGCCAGGCGGGGG + Intronic
1167970796 19:53187176-53187198 CGGGGCGGCTGGCCAGGCGGGGG + Intronic
1168343880 19:55641227-55641249 CGCCGGGGCCAGGCAGGCTGGGG + Intronic
1168350949 19:55675258-55675280 GGGCGCGGAGAGCCGGGCGGGGG - Intronic
925266930 2:2572037-2572059 CGCAGCAGCGGGCCCGGCGGAGG + Intergenic
925403171 2:3590411-3590433 CGGGGCGGCTGGCCAGGCGGGGG + Intergenic
925403273 2:3590637-3590659 CGGGGCGGCTGGCCAGGCGGGGG + Intergenic
925407540 2:3615876-3615898 CGCGGCGGCTGGCCGGGCGGGGG + Intronic
926639516 2:15220007-15220029 CGGGGCGGCTGGCCAGGCGGGGG + Intronic
927833211 2:26370856-26370878 CGGGGCGGCTGGCCAGGCGGGGG + Intronic
927938082 2:27086521-27086543 AGCCGCCCCGAGCCGGGCGGAGG - Intergenic
928002960 2:27539943-27539965 CGGGGCGGCTGGCCAGGCGGGGG + Intronic
928005307 2:27557791-27557813 CGGGGCGGCTGGCCAGGCGGGGG + Intronic
928542016 2:32293819-32293841 CGGGGCGGCTGGCCAGGCGGGGG + Intronic
928557994 2:32447581-32447603 CGGGGCGGCTGGCCAGGCGGGGG + Intronic
928585518 2:32754850-32754872 CGGGGCGGCTGGCCAGGCGGGGG + Intronic
929447750 2:42014512-42014534 CGGGGCGGCTGGCCAGGCGGGGG + Intergenic
929614579 2:43297560-43297582 CGGCACGGCTGGCCAGGCGGGGG - Intronic
929690160 2:44067177-44067199 CGGGGCGGCTGGCCAGGCGGGGG + Intergenic
929739722 2:44588709-44588731 CGGGGCGGCTGGCCAGGCGGGGG - Intronic
929739821 2:44588933-44588955 CGGGGCGGCTGGCCAGGCGGGGG - Intronic
930079117 2:47433074-47433096 CGGGGCGGCTGGCCAGGCGGGGG + Intronic
930201742 2:48555898-48555920 CGGGGCGGCTGGCCAGGCGGGGG + Intronic
930201814 2:48556046-48556068 CGGGGCGGCTGGCCAGGCGGGGG + Intronic
930201885 2:48556194-48556216 CGGGGCGGCTGGCCAGGCGGGGG + Intronic
930202034 2:48556546-48556568 CGGGGCGGCTGGCCAGGCGGGGG + Intronic
930762329 2:55050103-55050125 GGCCGCGGACAGCCCGGCGGCGG + Exonic
931783704 2:65601028-65601050 CGGGGCGGCTGGCCAGGCGGGGG + Intergenic
933684613 2:85133425-85133447 CGCCCCGGCGGAGCAGGCGGCGG + Exonic
935746506 2:106194078-106194100 CGCCGCGGTGGGCCGGGCGGCGG - Intronic
936546181 2:113394461-113394483 CGGCACGGCTGGCCAGGCGGGGG - Intergenic
936546281 2:113394687-113394709 CGGGGCGGCTGGCCAGGCGGGGG - Intergenic
937395445 2:121530619-121530641 CGCCGGGGCGGGGCTGGCGGGGG - Intronic
937919530 2:127119909-127119931 CGGCACGGCTGGCCAGGCGGGGG + Intergenic
937947521 2:127353581-127353603 CGGGGCGGCTGGCCAGGCGGGGG - Intronic
938088903 2:128418802-128418824 CGGGGCGGCTGGCCAGGCGGGGG + Intergenic
938534136 2:132221929-132221951 CGGGGCGGCTGGCCAGGCGGGGG - Intronic
939578413 2:143921963-143921985 CGGGGCGGCTGGCCAGGCGGGGG + Intergenic
940643514 2:156368941-156368963 CGGGGCGGCTGGCCAGGCGGGGG - Intergenic
940643642 2:156369215-156369237 CGGGGCGGCTGGCCAGGCGGGGG - Intergenic
941023896 2:160438993-160439015 CGGGGCGGCTGGCCAGGCGGGGG + Intronic
941786731 2:169506014-169506036 CGGGGCGGCTAGCCGGGCGGGGG - Exonic
941847826 2:170150039-170150061 CGGGGCGGCTGGCCAGGCGGGGG - Intergenic
941847926 2:170150293-170150315 CGGGGCGGCTGGCCAGGCGGGGG - Intergenic
942630230 2:177945839-177945861 CGGCACGGCTGGCCAGGCGGGGG - Intronic
942630328 2:177946064-177946086 CGGGGCGGCTGGCCAGGCGGGGG - Intronic
942754149 2:179319736-179319758 CGGGGCGGCTGGCCAGGCGGGGG + Intergenic
943297124 2:186154035-186154057 CGGCGCGGCTGGCCGGGCGGGGG + Intergenic
943739893 2:191398172-191398194 CGGGGCGGCTGGCCAGGCGGGGG + Intronic
944457594 2:199911425-199911447 CGCGGCGGCGACCCATGTGGGGG + Exonic
944532854 2:200683485-200683507 CGGGGCGGCTGGCCAGGCGGGGG + Intergenic
944532907 2:200683611-200683633 CGGGGCGGCTGGCCAGGCGGGGG + Intergenic
944598598 2:201283197-201283219 CGGGGCGGCTGGCCAGGCGGGGG + Intronic
944598670 2:201283371-201283393 CGGGGCGGCTGGCCAGGCGGGGG + Intronic
944732862 2:202534829-202534851 CGGGGCGGCTGGCCAGGCGGGGG + Intronic
945110334 2:206356252-206356274 CGGGGCGGCTGGCCAGGCGGGGG + Intergenic
945241556 2:207681461-207681483 CTCCGCGGCGAGGGCGGCGGCGG - Intergenic
946130738 2:217604702-217604724 CGCCGCCCCGTGCCAGGCCGTGG + Intronic
946742653 2:222816528-222816550 CGGGGCGGCTGGCCAGGCGGGGG - Intergenic
946751092 2:222896304-222896326 CGGGGCGGCTGGCCAGGCGGGGG + Intronic
947641154 2:231708570-231708592 GGCTGCGGCGAGCAAGGAGGCGG - Exonic
947765276 2:232633773-232633795 CGCCGAGGGGAGCCAGCTGGGGG - Exonic
947797943 2:232906180-232906202 CGGGGCGGCTGGCCAGGCGGGGG - Intronic
947901362 2:233724313-233724335 CGGGGCGGCTGGCCAGGCGGGGG + Intronic
948000472 2:234563003-234563025 CGGGGCGGCTAGCCAGGCGGGGG - Intergenic
948589140 2:239038437-239038459 CGGGGCGGCTGGCCAGGCGGGGG + Intergenic
948874724 2:240820424-240820446 CACCGCGGCGGGCCCCGCGGAGG + Intergenic
1169085819 20:2824250-2824272 CGGGGCGGCTGGCCAGGCGGGGG - Intergenic
1169370878 20:5027777-5027799 CGGGGCGGCTGGCCAGGCGGGGG - Intergenic
1169885587 20:10394920-10394942 CGGGGCGGCTGGCCAGGCGGGGG + Intergenic
1170424866 20:16227498-16227520 CGGGGCGGCTGGCCAGGCGGGGG + Intergenic
1171473562 20:25390617-25390639 CGCCGCGGCGGCCGAGCCGGAGG + Exonic
1171951665 20:31427181-31427203 CGGGGCGGCTCGCCAGGCGGGGG - Intergenic
1172279507 20:33699746-33699768 CGAGGCGGCTGGCCAGGCGGGGG - Intergenic
1172279581 20:33699921-33699943 CGAGGCGGCTGGCCAGGCGGGGG - Intergenic
1172279984 20:33701607-33701629 CGGGGCGGCCAGCCGGGCGGGGG - Intergenic
1172349480 20:34229767-34229789 CGGGGCGGCTGGCCAGGCGGAGG + Intronic
1172349802 20:34230520-34230542 CGGGGCGGCTGGCCAGGCGGAGG + Intronic
1172819490 20:37718615-37718637 CGGGGCGGCTGGCCAGGCGGGGG + Intronic
1173939071 20:46894766-46894788 CGGCGCGGGGACCCGGGCGGGGG + Exonic
1174066449 20:47869079-47869101 GGCTGCGATGAGCCAGGCGGAGG - Intergenic
1174218561 20:48935699-48935721 CGGGGCGGCTAGCCGGGCGGGGG + Intronic
1174218810 20:48936274-48936296 CGGGGCGGCTGGCCAGGCGGGGG + Intronic
1174506786 20:51022569-51022591 CGCCGCGGTGACCCCGGCGGGGG - Intronic
1174878303 20:54250490-54250512 CGGGGCGGCCAGCCGGGCGGGGG + Intergenic
1174878356 20:54250617-54250639 CGGGGCGGCTGGCCAGGCGGGGG + Intergenic
1176125227 20:63472079-63472101 CGCCGCAGCCAGCCTGGCCGGGG + Intronic
1177178490 21:17720564-17720586 CGGCACGGCTGGCCAGGCGGGGG + Intergenic
1180039558 21:45268922-45268944 CGGGGCGGCTGGCCAGGCGGGGG - Intronic
1180039609 21:45269049-45269071 CGGGGCGGCTGGCCAGGCGGGGG - Intronic
1180125188 21:45785477-45785499 CGGGGCGGCTGGCCAGGCGGGGG - Intronic
1181162147 22:20965416-20965438 CCCCGCGGCGAGCCGGGAAGGGG - Intronic
1181301453 22:21883768-21883790 CGGGGCGGCTGGCCAGGCGGGGG + Intergenic
1181586369 22:23855194-23855216 CGGGGCGGCTGGCCAGGCGGGGG - Intergenic
1181657841 22:24317288-24317310 CGGGGCGGCTGGCCAGGCGGGGG + Intronic
1181657990 22:24317636-24317658 CGGGGCGGCTGGCCAGGCGGGGG + Intronic
1181792285 22:25277739-25277761 CGGGGCGGCTGGCCAGGCGGGGG + Intergenic
1182539100 22:31027563-31027585 CGGGGCGGCTGGCCAGGCGGGGG - Intergenic
1182576477 22:31276576-31276598 CTCCGCGGCGAGGGCGGCGGCGG - Intronic
1182616386 22:31592156-31592178 CGGGGCGGCTGGCCAGGCGGAGG + Intronic
1182616586 22:31592608-31592630 CGGGGCGGCTGGCCAGGCGGAGG + Intronic
1182616685 22:31592833-31592855 CGGGGCGGCTGGCCAGGCGGGGG + Intronic
1182976260 22:34626077-34626099 CGGGGCGGCAAGCCGGGCGGGGG + Intergenic
1183595409 22:38807569-38807591 CGGGGCGGCTAGCCGGGCGGGGG - Intergenic
1183780229 22:39994826-39994848 GGTCCCGGCGAGCCCGGCGGAGG + Intergenic
1183845291 22:40537075-40537097 CGGCACGGCTGGCCAGGCGGGGG - Intronic
1183845588 22:40537780-40537802 CGGGGCGGCTGGCCAGGCGGGGG - Intronic
1183871622 22:40745336-40745358 CGGGGCGGCTGGCCAGGCGGGGG + Intergenic
1184101595 22:42343994-42344016 GGCCGCGGCGCGCCGGGCTGGGG + Intergenic
1184202873 22:42981884-42981906 CGGGGCGGCTGGCCAGGCGGGGG - Intronic
1185055078 22:48575292-48575314 CCCGCCGGCGCGCCAGGCGGGGG + Intronic
1185055257 22:48575853-48575875 CGCCGCGGCGGGCCAGGCTCGGG - Intronic
1203247444 22_KI270733v1_random:84900-84922 CGGGGCGGCTGGCCAGGCGGGGG + Intergenic
949992683 3:9592133-9592155 CGGGGCGGCTGGCCAGGCGGGGG - Intergenic
950253662 3:11487616-11487638 CGGCACGGCTGGCCAGGCGGGGG + Intronic
950729772 3:14947548-14947570 CGCGGCGGCGAGGCTGGCGCTGG + Intergenic
951013443 3:17705027-17705049 CGGGGCGGCTGGCCAGGCGGGGG + Intronic
951013465 3:17705076-17705098 CGGCACGGCTGGCCAGGCGGGGG + Intronic
951013488 3:17705124-17705146 CGGGGCGGCTGGCCAGGCGGGGG + Intronic
951013510 3:17705173-17705195 CGGCACGGCTGGCCAGGCGGGGG + Intronic
951013532 3:17705222-17705244 CGGCACGGCTGGCCAGGCGGGGG + Intronic
951013554 3:17705271-17705293 CGGCACGGCTGGCCAGGCGGGGG + Intronic
951290453 3:20866909-20866931 CGGGGCGGCTGGCCAGGCGGGGG + Intergenic
952896498 3:38081819-38081841 CGGCACGGCTGGCCAGGCGGGGG + Intronic
953404676 3:42654539-42654561 GGGCGCGGCCAGGCAGGCGGAGG - Intronic
954059387 3:48056225-48056247 CGGCACGGCTGGCCAGGCGGGGG - Intronic
954059488 3:48056451-48056473 CGGGGCGGCTGGCCAGGCGGGGG - Intronic
954080827 3:48211775-48211797 CGGGGCGGCTGGCCAGGCGGGGG - Intergenic
954162928 3:48734748-48734770 CGGGGCGGCTGGCCAGGCGGGGG - Intronic
954183299 3:48898502-48898524 CGCCCCAAAGAGCCAGGCGGCGG - Intronic
954399335 3:50311548-50311570 TGGGGCGGCTAGCCAGGCGGGGG + Intronic
954399602 3:50312143-50312165 CGGGGCGGCTGGCCAGGCGGGGG + Intronic
954468873 3:50674955-50674977 CGGCGCCGGGAGCCGGGCGGCGG + Intergenic
954599885 3:51859040-51859062 CGGGGCGGCTGGCCAGGCGGGGG - Intergenic
955161560 3:56468721-56468743 CGCCGCGGCCTGCCGGGAGGAGG - Intergenic
955297425 3:57747643-57747665 CGGCACGGCTGGCCAGGCGGGGG - Intergenic
955297447 3:57747692-57747714 CGGGGCGGCTGGCCAGGCGGGGG - Intergenic
956270393 3:67444023-67444045 CGGGGCGGCTGGCCAGGCGGGGG - Intronic
956270415 3:67444072-67444094 CGGCGCGGCTGGCCAGGCGGGGG - Intronic
956270437 3:67444121-67444143 CGGCACGGCTGGCCAGGCGGGGG - Intronic
956270532 3:67444347-67444369 CGGGGCGGCTGGCCAGGCGGGGG - Intronic
956678029 3:71753683-71753705 GGCGGCGGCGGGCCCGGCGGGGG + Intronic
958814500 3:98901308-98901330 CGCGATGGCGAGCCGGGCGGTGG - Exonic
959042691 3:101439510-101439532 CGGCACGGCTGGCCAGGCGGGGG - Intronic
959042791 3:101439736-101439758 CGGGGCGGCTGGCCAGGCGGGGG - Intronic
959085603 3:101849013-101849035 CGCCGCGCCGGGGCAGGCAGAGG + Intronic
959415204 3:106073719-106073741 CGGGGCGGCTGGCCAGGCGGGGG + Intergenic
959415302 3:106073940-106073962 CGGGGCGGCTGGCCAGGCGGGGG + Intergenic
959415545 3:106074504-106074526 CGGGGCGGCTGGCCAGGCGGGGG + Intergenic
959419311 3:106111753-106111775 CGGGGCGGCTGGCCAGGCGGGGG + Intergenic
960111497 3:113849898-113849920 CGGGGCGGCTGGCCAGGCGGGGG + Intronic
960577534 3:119242798-119242820 CGGGGCGGCTGGCCAGGCGGGGG - Intergenic
960862171 3:122164893-122164915 CGGGGCGGCTGGCCAGGCGGGGG - Intergenic
960866070 3:122201652-122201674 CGGGGCGGCTGGCCAGGCGGGGG + Intronic
961120396 3:124367438-124367460 CGGGGCGGCTGGCCAGGCGGGGG + Intronic
961120676 3:124368067-124368089 CGGGGCGGCTGGCCAGGCGGGGG + Intronic
961163670 3:124750045-124750067 CGGGGCGGCTGGCCAGGCGGGGG + Intergenic
961340393 3:126213337-126213359 CGCGGCGGAGAGCCTGGAGGAGG + Intergenic
961674278 3:128555405-128555427 CGCTGCGGAGAGACCGGCGGAGG + Intergenic
961735855 3:129001817-129001839 CGCCGCGGCAGTCCAGGTGGTGG - Exonic
961788663 3:129362431-129362453 CGGGGCGGCTGGCCAGGCGGGGG + Intergenic
961788943 3:129363111-129363133 CGGGGCGGCTGGCCAGGCGGGGG + Intergenic
961962557 3:130868434-130868456 CGGGGCGGCTGGCCAGGCGGGGG - Intronic
961962610 3:130868560-130868582 CGGGGCGGCTGGCCAGGCGGGGG - Intronic
962112901 3:132471043-132471065 CGGGGCGGCTGGCCAGGCGGGGG + Intronic
962244985 3:133784959-133784981 CGGGGCGGCTGGCCAGGCGGGGG - Intronic
963244483 3:143047150-143047172 CGGGGCGGCTGGCCAGGCGGGGG + Intronic
963244506 3:143047199-143047221 CGGGGCGGCCGGCCAGGCGGGGG + Intronic
963911283 3:150820303-150820325 CGGGGCGGCTGGCCAGGCGGGGG + Intergenic
963911355 3:150820450-150820472 CGGGGCGGCTGGCCAGGCGGGGG + Intergenic
966359632 3:179120129-179120151 CGGCACGGCTGGCCAGGCGGGGG - Intergenic
966359654 3:179120178-179120200 CGGCACGGCTGGCCAGGCGGGGG - Intergenic
966359975 3:179120903-179120925 CGGCACGGCTGGCCAGGCGGGGG - Intergenic
966783973 3:183608405-183608427 CGGGGCGGCTGGCCAGGCGGGGG - Intergenic
966784175 3:183608854-183608876 CGGGGCGGCTGGCCAGGCGGGGG - Intergenic
967176177 3:186864546-186864568 CGGGGCGGCTGGCCAGGCGGGGG - Intergenic
968173466 3:196528878-196528900 CTCCGCGGGGAGCTGGGCGGTGG + Intergenic
968258190 3:197297998-197298020 GGCCGCGGCGAGCGAGGAGGCGG - Intronic
968411751 4:396011-396033 CGGGGCGGCTGGCCAGGCGGGGG - Intergenic
968411775 4:396060-396082 CGGGGCGGCTGGCCAGGCGGGGG - Intergenic
968512785 4:1002834-1002856 CACCGCGGCGCGCCAGGCGTCGG - Exonic
968514600 4:1011004-1011026 GGCCGCGGCGATGCAGGCAGGGG - Exonic
968659805 4:1794260-1794282 CACCACGGGGAGCCAGGCTGGGG + Intronic
968667617 4:1829323-1829345 CGGGGCGGCTGGCCAGGCGGAGG + Intronic
968965154 4:3765955-3765977 AGCTCCGGCGAGCGAGGCGGCGG + Intergenic
969404236 4:6978129-6978151 CGGGGCGGCTAGCCGGGCGGGGG - Intronic
969413378 4:7043540-7043562 GGCTGCGGCGGGCCGGGCGGCGG + Exonic
969873186 4:10117005-10117027 GGGCGGGGCGAGCAAGGCGGAGG - Intergenic
969912118 4:10456939-10456961 CGCCGGGGCGACCGAGGCGGGGG - Intronic
970409563 4:15791687-15791709 CGGGGCGGCTGGCCAGGCGGGGG - Intronic
971457931 4:26861319-26861341 CGCCGCGGCGGGAGAGGAGGCGG - Exonic
972288292 4:37669018-37669040 CGGGGCGGCTGGCCAGGCGGGGG - Intronic
972288316 4:37669067-37669089 CGGGGCGGCTGGCCAGGCGGGGG - Intronic
973281370 4:48363722-48363744 CGGGGCGGCTGGCCAGGCGGGGG + Intronic
973281445 4:48363900-48363922 CGGCACGGCTGGCCAGGCGGGGG + Intronic
973593502 4:52465116-52465138 CGGCACGGCTGGCCAGGCGGGGG - Intergenic
975042480 4:69762200-69762222 CGGGGCGGCTGGCCAGGCGGGGG - Intronic
975685940 4:76917682-76917704 CGGGGCGGCTGGCCAGGCGGGGG - Intergenic
975686064 4:76917957-76917979 CGGGGCGGCTGGCCAGGCGGGGG - Intergenic
976265811 4:83185778-83185800 CGGGGCGGCTGGCCAGGCGGGGG + Intergenic
979248308 4:118535340-118535362 CGGGGCGGCTGGCCAGGCGGGGG - Intergenic
980923944 4:139115459-139115481 CGCCGCGGCGAGGGCAGCGGCGG + Intronic
981429888 4:144646232-144646254 GGCGGCGGCGGGGCAGGCGGAGG - Exonic
981524301 4:145694610-145694632 CGGGGCGGCTGGCCAGGCGGGGG - Intronic
982615906 4:157637108-157637130 CGGCACGGCTGGCCAGGCGGGGG + Intergenic
982615929 4:157637157-157637179 CGGCGCGGCTGGCCGGGCGGGGG + Intergenic
982709571 4:158746391-158746413 CGGGGCGGCTGGCCAGGCGGGGG + Intergenic
982784754 4:159524566-159524588 CGGGGCGGCTGGCCAGGCGGGGG - Intergenic
983190316 4:164747405-164747427 CGGGGCGGCTGGCCAGGCGGGGG + Intergenic
984804156 4:183736777-183736799 CGGGGCGGCTGGCCAGGCGGGGG + Intergenic
984804208 4:183736903-183736925 CGGGGCGGCCAGCCGGGCGGGGG + Intergenic
985540182 5:484133-484155 CGGCGGGGCGAGCCAGCCAGGGG - Intronic
985540204 5:484192-484214 CGGCGGGGCGAGCCAGCCAGGGG - Intronic
985540226 5:484251-484273 CGGCGGGGCGAGCCAGCCAGGGG - Intronic
985540248 5:484310-484332 CGGCGGGGCGAGCCAGCCAGGGG - Intronic
985540270 5:484369-484391 CGGCGGGGCGAGCCAGCCAGGGG - Intronic
986608256 5:9544809-9544831 CGCCGCGGGGAGCGAGCCGGGGG + Intronic
988544462 5:32142711-32142733 CGGGGCGGCTGGCCAGGCGGGGG - Intronic
988552151 5:32208437-32208459 CGGGGCGGCTGGCCAGGCGGGGG - Intergenic
989021410 5:37013146-37013168 CGGGGCGGCTGGCCAGGCGGGGG + Intronic
989048472 5:37295888-37295910 CGGGGCGGCTGGCCAGGCGGGGG - Intronic
989379753 5:40800657-40800679 CGGGGCGGCTGGCCAGGCGGGGG - Intergenic
989587607 5:43087427-43087449 CGGGGCGGCTGGCCAGGCGGGGG + Intronic
989587731 5:43087700-43087722 CGGGGCGGCTGGCCAGGCGGGGG + Intronic
989587883 5:43088050-43088072 CGGGGCGGCTGGCCAGGCGGGGG + Intronic
990426980 5:55696676-55696698 CGGGGCGGCTGGCCAGGCGGGGG + Intronic
991907321 5:71525711-71525733 CGGGGCGGCTGGCCAGGCGGGGG + Intronic
992289892 5:75271004-75271026 CGAGGCGGCTGGCCAGGCGGGGG - Intergenic
992373909 5:76171722-76171744 CGGCACGGCTGGCCAGGCGGGGG - Intronic
992374009 5:76171948-76171970 CGGGGCGGCTGGCCAGGCGGGGG - Intronic
992443059 5:76812583-76812605 CGGGGCGGCTAGCCGGGCGGGGG - Intergenic
992443177 5:76812879-76812901 CGTGGCGGCTGGCCAGGCGGGGG - Intergenic
992470025 5:77043560-77043582 CGGCACGGCTGGCCAGGCGGGGG + Intronic
992563236 5:77972887-77972909 CGCCGCGCCGGGCCACGTGGGGG - Intergenic
994043612 5:95284649-95284671 CGCCGCGGGGACCCGGGAGGAGG - Intergenic
994631711 5:102295838-102295860 GGGCACGGCGAGCCAGCCGGGGG - Intronic
995123596 5:108559284-108559306 CGGGGCGGCTGGCCAGGCGGGGG + Intergenic
995193365 5:109341612-109341634 CGGGGCGGCTGGCCAGGCGGGGG - Intronic
995193465 5:109341837-109341859 CGGGGCGGCTGGCCAGGCGGGGG - Intronic
995193841 5:109342664-109342686 CGGGGCGGCTGGCCAGGCGGGGG - Intronic
996329430 5:122312307-122312329 CGCCGCGGGGAGGCGGGAGGCGG + Intronic
997302089 5:132813654-132813676 TGCCGGGGTGAGCCAGGCGGCGG + Exonic
997560974 5:134846048-134846070 GGCGGCGGCGAGGCAGGCGCTGG - Exonic
997874860 5:137538034-137538056 CGGGGCGGCTGGCCAGGCGGGGG + Intronic
997892291 5:137687132-137687154 CGGGGCGGCTGGCCAGGCGGGGG - Intronic
997930782 5:138070431-138070453 CGGGGCGGCTGGCCAGGCGGGGG - Intergenic
998021736 5:138776777-138776799 CGGGGCGGCTGGCCAGGCGGGGG + Intronic
998053730 5:139056657-139056679 CGGGGCGGCTGGCCAGGCGGGGG - Intronic
998239276 5:140427348-140427370 CGGGGCGGCTGGCCAGGCGGGGG + Intronic
998432030 5:142076139-142076161 CGGGGCGGCTGGCCAGGCGGGGG + Intergenic
999768170 5:154756040-154756062 GGCGGCGGCGAGCCAGGCGCTGG + Intronic
1000985469 5:167859569-167859591 CGGGGCGGCTGGCCAGGCGGGGG - Intronic
1001393964 5:171403663-171403685 CGGGGCGGCTGGCCAGGCGGGGG + Intronic
1001394064 5:171403888-171403910 CGGGGCGGCCGGCCAGGCGGGGG + Intronic
1002013701 5:176305153-176305175 CGGCACGGCTGGCCAGGCGGGGG - Intronic
1002013792 5:176305368-176305390 CGGCACGGCTGGCCAGGCGGGGG - Intronic
1002013865 5:176305543-176305565 CGGGGCGGCTGGCCAGGCGGGGG - Intronic
1002541208 5:179907649-179907671 CGCCGCGGCTGGGCTGGCGGCGG - Intronic
1002897681 6:1389153-1389175 CGGCCCGGCGGGCCAGGAGGAGG + Intergenic
1004388146 6:15189148-15189170 CGGGGCGGCTGGCCAGGCGGGGG - Intergenic
1004414917 6:15415719-15415741 CGGGGCGGCTGGCCAGGCGGAGG + Intronic
1004562483 6:16762581-16762603 CCTGGCGGCGAGACAGGCGGAGG - Intergenic
1005063333 6:21796913-21796935 CGCGGCGGCTGGCCGGGCGGGGG + Intergenic
1005063404 6:21797091-21797113 CGGGGCGGCTAGCCGGGCGGGGG + Intergenic
1005063478 6:21797271-21797293 CGGGGCGGCTAGCCGGGCGGGGG + Intergenic
1005069579 6:21851503-21851525 CGGGGCGGCTGGCCAGGCGGGGG + Intergenic
1005069720 6:21851824-21851846 CGGGGCGGCTGGCCAGGCGGGGG + Intergenic
1005473927 6:26188950-26188972 CGCCGCGGCGAGCCAGGCGGCGG + Exonic
1005475615 6:26204749-26204771 CCCCGCGACGAGCAAGGCGCCGG - Exonic
1005479319 6:26240530-26240552 CGCCGCGTCGGGCCAAGCGACGG - Exonic
1005484327 6:26285373-26285395 CGCCGCGACGAGCAAGGCGCCGG + Exonic
1005643990 6:27824229-27824251 CGCCGCGGCGAGCAAGGCGCCGG - Exonic
1005645207 6:27831401-27831423 CGCCGCGGCGAGCAAGGCGCCGG + Exonic
1006039738 6:31244092-31244114 CGGGGCGGCTGGCCAGGCGGGGG - Intergenic
1006141344 6:31931918-31931940 CGGCGCGGCTGGCCGGGCGGGGG + Intronic
1006492440 6:34397934-34397956 CGGGGCGGCTGGCCAGGCGGGGG - Intronic
1006623909 6:35384672-35384694 CGGGGCGGCTGGCCAGGCGGGGG - Intronic
1006623985 6:35384847-35384869 CGGGGCGGCTGGCCAGGCGGGGG - Intronic
1007674250 6:43580917-43580939 CGGCACGGCTGGCCAGGCGGGGG + Intronic
1007739144 6:44000515-44000537 CGCCGCGGCAGGCCAGGGGAGGG + Intergenic
1007785234 6:44276027-44276049 CGCTGCGGCGGGGCAGGCGGCGG + Exonic
1008926516 6:56894958-56894980 CGGGGCGGCTGGCCAGGCGGGGG + Intronic
1009431653 6:63572644-63572666 GGCGGCGGCGACACAGGCGGTGG - Exonic
1010030267 6:71266064-71266086 CGCGGCGGCTGGCCGGGCGGGGG + Intergenic
1010319357 6:74488794-74488816 TGGGGCGGCTAGCCAGGCGGGGG - Intergenic
1011426718 6:87239326-87239348 CGGGGCGGCTGGCCAGGCGGGGG + Intronic
1011588399 6:88948321-88948343 CGGGGCGGCTGGCCAGGCGGGGG - Intronic
1012237669 6:96837432-96837454 GGCGGCGGCGATACAGGCGGCGG + Exonic
1014556972 6:122849105-122849127 CGGGGCGGCTGGCCAGGCGGGGG + Intergenic
1014764085 6:125388947-125388969 CGGGGCGGCTGGCCAGGCGGGGG + Intergenic
1015476820 6:133665169-133665191 CGGGGCGGCTGGCCAGGCGGGGG - Intergenic
1016739098 6:147509208-147509230 CGCCGGGGGGAGCCGTGCGGCGG + Exonic
1017146687 6:151240910-151240932 AGCAGCGGCGAGCGCGGCGGGGG + Intronic
1017215067 6:151899326-151899348 CGGGGCGGCTGGCCAGGCGGGGG + Intronic
1017660727 6:156670504-156670526 CGGGGCGGCTGGCCAGGCGGGGG - Intergenic
1017662440 6:156687487-156687509 CGGCTCGGCGAGCGCGGCGGCGG + Intergenic
1017843980 6:158240772-158240794 CGGCACGGCTGGCCAGGCGGGGG + Intronic
1018295412 6:162339303-162339325 CGGCGCGGCTGGCCGGGCGGGGG - Intronic
1019112080 6:169724465-169724487 GGCCGTGGGGAGCCAGGCGGCGG - Intronic
1019439287 7:1038493-1038515 CGGGGCGGCTGGCCAGGCGGGGG - Intronic
1019445809 7:1070318-1070340 CGGCACGGCTGGCCAGGCGGGGG - Intronic
1019458803 7:1146389-1146411 CGGGGCGGCTGGCCAGGCGGGGG + Intergenic
1019498628 7:1353061-1353083 CGCCGCCGCCACCCAGGCCGAGG - Intergenic
1020105704 7:5421355-5421377 CTCCGCGGCGTGCATGGCGGCGG + Exonic
1020616356 7:10465632-10465654 CGGGGCGGCTGGCCAGGCGGGGG + Intergenic
1021106559 7:16645461-16645483 GGCCGCGGCCAGCCTGGCCGGGG - Intronic
1021647481 7:22801236-22801258 CGAGGCGGCTGGCCAGGCGGGGG - Intergenic
1021963548 7:25895529-25895551 CGCCGGGGCGGGCCAGCAGGGGG - Intergenic
1022101967 7:27174173-27174195 GGCAGAGGCGAGGCAGGCGGCGG - Exonic
1023160668 7:37292929-37292951 CGGGGCGGCTGGCCAGGCGGGGG - Intronic
1024499819 7:50093150-50093172 CAGCGCGGCGGGGCAGGCGGCGG - Exonic
1025011585 7:55402578-55402600 CGGGGCGGCTGGCCAGGCGGGGG + Intronic
1025821584 7:64968168-64968190 CGGGGCGGCTGGCCAGGCGGGGG + Intergenic
1025979290 7:66393756-66393778 CGGGGCGGCTGGCCAGGCGGGGG + Intronic
1026783359 7:73284298-73284320 CGGCACGGCTGGCCAGGCGGGGG + Intergenic
1026806828 7:73434112-73434134 GGCTGCGCCGTGCCAGGCGGTGG + Exonic
1027333253 7:77121932-77121954 CGGCGCGCCGGGCCAGGCGGAGG + Intergenic
1027371150 7:77509390-77509412 CGGCACGGCTGGCCAGGCGGGGG - Intergenic
1027371248 7:77509615-77509637 CGGGGCGGCTGGCCAGGCGGGGG - Intergenic
1027371271 7:77509664-77509686 CGGGGCGGCTGGCCAGGCGGAGG - Intergenic
1029429845 7:100523124-100523146 CGGGGCGGCTGGCCAGGCGGGGG + Intergenic
1029568942 7:101358603-101358625 CGGGGCGGCTGGCCAGGCGGGGG + Intergenic
1029782539 7:102749370-102749392 CGGCGCCCCGGGCCAGGCGGAGG - Exonic
1033186423 7:139231270-139231292 GGCCGCGGCGACCCTGGCGATGG + Intronic
1033323955 7:140362787-140362809 CGGGGCGGCTGGCCAGGCGGGGG - Intronic
1033654364 7:143362808-143362830 GGCCGCGGCGAGCCGAGCCGGGG - Intergenic
1033899287 7:146116179-146116201 CCGGGCGGCGAGCGAGGCGGAGG - Intergenic
1034207840 7:149333166-149333188 CGGGGCGGCTGGCCAGGCGGGGG + Intergenic
1034234141 7:149554707-149554729 CGGCGCGGCTGGCCGGGCGGGGG - Intergenic
1034322553 7:150198767-150198789 CGGCACGGCTGGCCAGGCGGGGG - Intergenic
1034361855 7:150506364-150506386 CGGGGCGGCGGGCCGGGCGGGGG + Intergenic
1034638546 7:152585732-152585754 CGGGGCGGCTGGCCAGGCGGGGG + Intergenic
1034961676 7:155367419-155367441 CGGGGCGGCTGGCCAGGCGGGGG + Intronic
1034961750 7:155367593-155367615 CGGGGCGGCTGGCCAGGCGGGGG + Intronic
1036096014 8:5725560-5725582 CGGGGCGGCTGGCCAGGCGGGGG - Intergenic
1038595142 8:28881137-28881159 CGGGGCGGCCAGCCGGGCGGGGG - Intronic
1038595216 8:28881313-28881335 CGGGGCGGCTGGCCAGGCGGGGG - Intronic
1038595348 8:28881589-28881611 CGGGGCGGCTGGCCAGGCGGGGG - Intronic
1038744696 8:30246658-30246680 CGGGGCGGCTGGCCAGGCGGGGG + Intergenic
1040062296 8:43114323-43114345 GGCCGCAGCGAGCCTGGGGGAGG - Intronic
1040818898 8:51534856-51534878 CGGGGCGGCTGGCCAGGCGGGGG - Intronic
1041070798 8:54125455-54125477 CGGGGCGGCTGGCCAGGCGGGGG - Intergenic
1041355248 8:56993443-56993465 CTGGGCGGCGAGCCTGGCGGCGG - Exonic
1041369310 8:57142738-57142760 ACTCGCGGCGAGCCGGGCGGCGG + Intergenic
1041676796 8:60547630-60547652 CGGGGCGGCTGGCCAGGCGGGGG + Intronic
1041796592 8:61753105-61753127 CGGCACGGCTGGCCAGGCGGGGG + Intergenic
1042049019 8:64685887-64685909 CGGCACGGCTGGCCAGGCGGGGG - Intronic
1042049252 8:64686417-64686439 CGGGGCGGCTGGCCAGGCGGGGG - Intronic
1042303827 8:67311576-67311598 CGAGGCGGCTGGCCAGGCGGGGG - Intronic
1043873811 8:85463743-85463765 GGCCGAGGGGAGCCGGGCGGCGG + Intergenic
1044660672 8:94590916-94590938 CGGCACGGCTGGCCAGGCGGGGG - Intergenic
1045432201 8:102124352-102124374 GGAGGCGGCGAGCCAGGCTGGGG - Intronic
1046636542 8:116679421-116679443 CGGGGCGGCTGGCCAGGCGGGGG - Intronic
1046636643 8:116679646-116679668 CGGGGCGGCTGGCCAGGCGGGGG - Intronic
1046636840 8:116680088-116680110 CGGGGCGGCTGGCCAGGCGGGGG - Intronic
1047687268 8:127316443-127316465 CGGCACGGCTGGCCAGGCGGGGG - Intergenic
1047782103 8:128118852-128118874 CGGGGCGGCTGGCCAGGCGGGGG + Intergenic
1047847983 8:128826261-128826283 CGGGGCGGCTGGCCAGGCGGGGG + Intergenic
1049707323 8:144048949-144048971 TGACGCAGCGAGCCTGGCGGAGG - Intergenic
1049799167 8:144509848-144509870 GGCCGCGGCCAGCCAGTAGGTGG - Exonic
1051280919 9:15442087-15442109 CGGGGCGGCTGGCCAGGCGGGGG + Intronic
1052858667 9:33423506-33423528 CGGGGCGGCTGGCCAGGCGGGGG - Intergenic
1053255779 9:36615223-36615245 CGGCACGGCTGGCCAGGCGGGGG + Intronic
1053255800 9:36615272-36615294 CGGCACGGCTGGCCAGGCGGGGG + Intronic
1053255869 9:36615419-36615441 CGGCACGGCTGGCCAGGCGGGGG + Intronic
1053409144 9:37904271-37904293 CGCCGCGGCGGGGCAGGTAGAGG + Intronic
1053457349 9:38242427-38242449 CGGGGCGGCTGGCCAGGCGGGGG - Intergenic
1053690457 9:40584306-40584328 GGCGGCGGCGAGGCGGGCGGCGG - Intergenic
1053690463 9:40584324-40584346 GGCGGCGGCGAGGCGGGCGGCGG - Intergenic
1053690469 9:40584342-40584364 CGCGGCGGAGAGGCGGGCGGCGG - Intergenic
1053690477 9:40584368-40584390 CGCGGCGGAGAGGCGGGCGGCGG - Intergenic
1053690485 9:40584394-40584416 CGCGGCGGAGAGGCGGGCGGCGG - Intergenic
1053690494 9:40584423-40584445 CGCGGCGGAGAGGCGGGCGGCGG - Intergenic
1053690502 9:40584449-40584471 CGCGGCGGAGAGGCGGGCGGCGG - Intergenic
1053690510 9:40584475-40584497 CGCGGCGGAGAGGCGGGCGGCGG - Intergenic
1054274335 9:63053125-63053147 CGCGGCGGAGAGGCGGGCGGCGG + Intergenic
1054274341 9:63053143-63053165 GGCGGCGGCGAGGCGGGCGGCGG + Intergenic
1054301705 9:63385249-63385271 GGCGGCGGCGAGGCGGGCGGCGG - Intergenic
1054301711 9:63385267-63385289 CGCGGCGGAGAGGCGGGCGGCGG - Intergenic
1054301719 9:63385293-63385315 CGCGGCGGAGAGGCGGGCGGCGG - Intergenic
1054301727 9:63385319-63385341 CGCGGCGGAGAGGCGGGCGGCGG - Intergenic
1054301735 9:63385345-63385367 CGCGGCGGAGAGGCGGGCGGCGG - Intergenic
1054301743 9:63385371-63385393 CGCGGCGGAGAGGCGGGCGGCGG - Intergenic
1054301751 9:63385397-63385419 CGCGGCGGAGAGGCGGGCGGCGG - Intergenic
1054301759 9:63385423-63385445 CGCGGCGGAGAGGCGGGCGGCGG - Intergenic
1054400482 9:64711785-64711807 GGCGGCGGCGAGGCGGGCGGCGG - Intergenic
1054400488 9:64711803-64711825 GGCGGCGGCGAGGCGGGCGGCGG - Intergenic
1054400494 9:64711821-64711843 CGCGGCGGAGAGGCGGGCGGCGG - Intergenic
1054400502 9:64711847-64711869 CGCGGCGGAGAGGCGGGCGGCGG - Intergenic
1054434080 9:65196065-65196087 GGCGGCGGCGAGGCGGGCGGCGG - Intergenic
1054434086 9:65196083-65196105 GGCGGCGGCGAGGCGGGCGGCGG - Intergenic
1054496305 9:65825602-65825624 GGCGGCGGCGAGGCGGGCGGCGG + Intergenic
1054496311 9:65825620-65825642 GGCGGCGGCGAGGCGGGCGGCGG + Intergenic
1054496317 9:65825638-65825660 GGCGGCGGCGAGGCGGGCGGCGG + Intergenic
1055137115 9:72840585-72840607 CGGGGCGGCTGGCCAGGCGGGGG + Intergenic
1055138631 9:72851208-72851230 CGGGGCGGCTGGCCAGGCGGGGG + Intergenic
1055138682 9:72851334-72851356 CGGGGCGGCTGGCCAGGCGGGGG + Intergenic
1055414166 9:76064160-76064182 CGGGGCGGCTGGCCAGGCGGGGG + Intronic
1055414265 9:76064385-76064407 CGGCACGGCTGGCCAGGCGGGGG + Intronic
1055586580 9:77762261-77762283 CGGGGCGGCTGGCCAGGCGGGGG - Intronic
1055948432 9:81710701-81710723 CGGGGCGGCTGGCCAGGCGGGGG - Intergenic
1056152754 9:83804635-83804657 CGGGGCGGCTGGCCAGGCGGGGG - Intronic
1057087838 9:92227538-92227560 CGGGGCGGCTGGCCAGGCGGAGG + Intronic
1057154770 9:92830887-92830909 CGGGGCGGCTGGCCAGGCGGGGG + Intergenic
1057358022 9:94347659-94347681 AGCCGCGGCGAGCAAGGAGCTGG + Intergenic
1057649727 9:96909958-96909980 AGCCGCGGCGAGCAAGGAGCTGG - Intronic
1058659786 9:107257305-107257327 CGGGGCGGCTGGCCAGGCGGGGG + Intergenic
1059120876 9:111640963-111640985 CGGCACGGCTGGCCAGGCGGGGG - Intronic
1059120974 9:111641189-111641211 CGGGGCGGCTGGCCAGGCGGGGG - Intronic
1059211068 9:112514412-112514434 CGGCACGGCTGGCCAGGCGGGGG - Intronic
1060065086 9:120495991-120496013 CGGGGCGGCTGGCCAGGCGGGGG - Intronic
1060350139 9:122852418-122852440 CGGGGCGGCTGGCCAGGCGGGGG - Intronic
1060629595 9:125143546-125143568 CCCCGCGGCAAGCCTGGCAGAGG - Intergenic
1060687218 9:125623995-125624017 CGGGGCGGCTGGCCAGGCGGGGG - Intronic
1061208615 9:129178131-129178153 CGCCGGGGCGCGCCGGGCAGGGG + Exonic
1061326827 9:129869259-129869281 CGCCCCGGCCAGGCAGGTGGAGG + Intronic
1061427127 9:130506549-130506571 CGGGGCGGCTGGCCAGGCGGGGG + Intergenic
1061540734 9:131276912-131276934 GGCCGCGGCGAAGCAGGCGGCGG - Intergenic
1061623005 9:131823946-131823968 CGCCGCGGAGAGCCCGGCGCCGG + Intergenic
1061805875 9:133137600-133137622 GGCAGAGGCAAGCCAGGCGGGGG + Intronic
1061982859 9:134115965-134115987 CGGGGCGGCTGGCCAGGCGGAGG + Intergenic
1061983183 9:134116719-134116741 CGGGGCGGCTGGCCAGGCGGAGG + Intergenic
1061983484 9:134117424-134117446 CGGGGCGGCTGGCCAGGCGGAGG + Intergenic
1061983808 9:134118178-134118200 CGGGGCGGCTGGCCAGGCGGAGG + Intergenic
1061983909 9:134118404-134118426 CGGCACGGCTGGCCAGGCGGGGG + Intergenic
1062615732 9:137394943-137394965 TCCCTCGGGGAGCCAGGCGGAGG - Intronic
1062629976 9:137459156-137459178 CGGCGCGGCTACCCCGGCGGAGG - Exonic
1203463776 Un_GL000220v1:67960-67982 CGGGGCGGCTGGCCAGGCGGGGG + Intergenic
1187698113 X:21940917-21940939 CGCCCCAGCCCGCCAGGCGGCGG - Intronic
1187976447 X:24709268-24709290 CGGCACGGCTGGCCAGGCGGGGG + Intronic
1187976514 X:24709415-24709437 CGGCACGGCTGGCCAGGCGGGGG + Intronic
1188367554 X:29333509-29333531 CGGGGCGGCTGGCCAGGCGGGGG + Intronic
1188367727 X:29333902-29333924 CGGGGCGGCTGGCCAGGCGGGGG + Intronic
1188477154 X:30602463-30602485 CGGCACGGCTGGCCAGGCGGGGG - Intergenic
1188477253 X:30602687-30602709 CGGGGCGGCTGGCCAGGCGGGGG - Intergenic
1189837692 X:45040600-45040622 CGGGGCGGCTGGCCAGGCGGGGG + Intronic
1190680855 X:52826841-52826863 CGGGGCGGCTGGCCAGGCGGGGG + Intergenic
1190779140 X:53578690-53578712 CGGGGCGGCTGGCCAGGCGGGGG - Intronic
1190779241 X:53578915-53578937 CGGGGCGGCTGGCCAGGCGGGGG - Intronic
1191010106 X:55749199-55749221 CGGGGCGGCTGGCCAGGCGGGGG - Intronic
1191618120 X:63189672-63189694 CGGCACGGCTGGCCAGGCGGGGG + Intergenic
1191618142 X:63189721-63189743 CGGCACGGCTGGCCAGGCGGGGG + Intergenic
1192567849 X:72179070-72179092 CGGGGCGGCTGGCCAGGCGGGGG - Intergenic
1192768708 X:74166967-74166989 CGGGGCGGCTGGCCAGGCGGGGG - Intergenic
1192818068 X:74614741-74614763 CGACGCGGCAAGGCGGGCGGCGG + Intergenic
1196404366 X:115347467-115347489 CGGCACGGCTGGCCAGGCGGGGG + Intergenic
1196404387 X:115347516-115347538 CGGCACGGCTGGCCAGGCGGGGG + Intergenic
1198767089 X:140091328-140091350 GGCGGCGGCGACCGAGGCGGCGG + Intergenic
1199699062 X:150363281-150363303 CGCGGCGCGGAGCCGGGCGGTGG + Intronic