ID: 1005473929

View in Genome Browser
Species Human (GRCh38)
Location 6:26188957-26188979
Sequence GCGAGCCAGGCGGCGGATAG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 70}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005473921_1005473929 17 Left 1005473921 6:26188917-26188939 CCTCATAAATGAGGCCAGAAATA 0: 1
1: 0
2: 3
3: 28
4: 292
Right 1005473929 6:26188957-26188979 GCGAGCCAGGCGGCGGATAGCGG 0: 1
1: 0
2: 0
3: 3
4: 70
1005473919_1005473929 27 Left 1005473919 6:26188907-26188929 CCGCGAGTTTCCTCATAAATGAG 0: 1
1: 0
2: 1
3: 15
4: 99
Right 1005473929 6:26188957-26188979 GCGAGCCAGGCGGCGGATAGCGG 0: 1
1: 0
2: 0
3: 3
4: 70
1005473922_1005473929 3 Left 1005473922 6:26188931-26188953 CCAGAAATACGCTTGACGCCGCC 0: 1
1: 0
2: 4
3: 7
4: 15
Right 1005473929 6:26188957-26188979 GCGAGCCAGGCGGCGGATAGCGG 0: 1
1: 0
2: 0
3: 3
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005473929 Original CRISPR GCGAGCCAGGCGGCGGATAG CGG Exonic
900720782 1:4174540-4174562 GAGAGGCAGGAGGCGGACAGAGG + Intergenic
904028892 1:27521677-27521699 GCGAGCCAGCCGGTGGAGGGAGG + Intergenic
914801991 1:150968680-150968702 GCCAGGCGGGCGGCGGGTAGAGG + Intronic
916090664 1:161305847-161305869 GCGGGCCGGGCGGGGGATCGGGG - Exonic
916479382 1:165201478-165201500 GAGAGCCAGGCAGCAGATCGTGG - Intergenic
916497244 1:165356734-165356756 GCGTGCGCGGCGGCGGAGAGGGG + Intergenic
916883327 1:169043840-169043862 GGGATCCAGGTGGCAGATAGTGG + Intergenic
1063058332 10:2525927-2525949 GGGAGCAAGGCGGCTGGTAGTGG - Intergenic
1065694854 10:28370312-28370334 GCAAGCCAGGTGGTGGGTAGTGG + Intergenic
1067069096 10:43119514-43119536 GCGGGCCTGGGGGCGGAGAGAGG - Exonic
1073489158 10:103841285-103841307 GGGAGCCAGGAGGCAGGTAGGGG - Intronic
1089769640 11:120793908-120793930 GAGAGCCAGGCGGTGTTTAGGGG + Intronic
1089769708 11:120794235-120794257 GAGAGCCAGGCGATGGTTAGCGG + Intronic
1090945469 11:131425988-131426010 GCGAGACATGAGGCTGATAGTGG + Intronic
1091718419 12:2795545-2795567 GCGCGCGGGGCGGCGGAGAGGGG + Intronic
1115028464 14:28767662-28767684 GCGAGCCGGGCGGCGGGCCGGGG + Exonic
1126736619 15:51737535-51737557 GCGAGCGCGGCGGCGGCGAGGGG + Exonic
1128264314 15:66253713-66253735 GGGAGCCGGGCGGCGGGCAGCGG + Exonic
1128727451 15:69998683-69998705 GCGGGCCAGCCGGAGGAGAGGGG + Intergenic
1133028458 16:2998633-2998655 GGGATCCAGGCAGGGGATAGAGG - Intergenic
1142374688 16:89701005-89701027 GCGAGCCAGGCCGCGTAGCGCGG + Exonic
1143544496 17:7588434-7588456 GAGAGCCAGGGGGCAGGTAGTGG + Exonic
1148240815 17:45998386-45998408 GCGTGCCAGGCGGTGCACAGAGG + Intronic
1148464699 17:47857898-47857920 GGGGGCCAGGGGGCGGGTAGGGG - Intergenic
1151347494 17:73511050-73511072 GCCAGCCGGGCGGCGGGCAGTGG - Intronic
1151993424 17:77593305-77593327 GCCACCCAGGGGGCGGACAGAGG - Intergenic
1152551283 17:81031629-81031651 GCAAGCCAGGCGAAGGATTGGGG - Intergenic
1152612407 17:81322347-81322369 GGGAGCCAGGCTGCGGGGAGAGG - Intronic
1160623523 18:80187606-80187628 GGGAGCCAGGAGGTGGATGGGGG - Intronic
1161136397 19:2622524-2622546 GCGAGCAACGCGGCAGAGAGGGG + Intronic
1161136410 19:2622570-2622592 GCGAGCAACGCGGCAGAGAGGGG + Intronic
1161136424 19:2622617-2622639 GCGAGCAACGCGGCAGAGAGGGG + Intronic
1161136438 19:2622664-2622686 GCGAGCAACGCGGCAGATAGGGG + Intronic
1161136475 19:2622804-2622826 GCGAGCAACGCGGCAGAGAGGGG + Intronic
1163914202 19:20225293-20225315 GCTAGTCAGGAGGCTGATAGAGG + Intergenic
1164595528 19:29528895-29528917 GCAATCCAGGCGGAGGATAAAGG - Intronic
1165329727 19:35134767-35134789 GCGTGCCAGCAGGCGGATGGAGG - Exonic
1166777211 19:45320382-45320404 GCGAGCTAGGCGGGGCACAGTGG - Intronic
1166837845 19:45678075-45678097 GCGAGCCAGCCTGGGGAGAGAGG - Exonic
926391587 2:12399527-12399549 CGGAGCCAGGCAGAGGATAGAGG + Intergenic
944741521 2:202617409-202617431 GGGAGGCAGGCGGAGGCTAGGGG - Intergenic
1168842099 20:916120-916142 ACAAGGCAGGAGGCGGATAGGGG - Exonic
1171124102 20:22586849-22586871 GCGGGCCTGGCGGCCGACAGGGG - Intergenic
1172829713 20:37823310-37823332 GCCAGTCAGGCGGCAGTTAGAGG - Intronic
1173880254 20:46406497-46406519 GCGCGGCAGGCGGTGGAGAGGGG - Intronic
1175901851 20:62363068-62363090 GCAAGCCAGGGGGCGGAAGGGGG + Intronic
1184796917 22:46738144-46738166 ACGAGCCCGGCGGCGGAGATGGG - Exonic
1185093017 22:48786448-48786470 GTGAGCCAGGCAGGGGATGGGGG + Intronic
963939830 3:151086813-151086835 GCGAGCGAGGAGGGGGAGAGAGG + Intronic
969330360 4:6471067-6471089 GTGGGCCAGGCGGCGGAGACCGG - Intronic
984734641 4:183098547-183098569 GCGAGCCGCGCGGCGGAAAGCGG - Intergenic
990948624 5:61275252-61275274 GAGAGCCAGGTAGCGGAGAGAGG - Intergenic
990954666 5:61331003-61331025 GCGTGCCAGGCGGCGGACGGCGG - Intergenic
1001277182 5:170359478-170359500 GCGAGCCAGGACTCGGATGGTGG - Intronic
1005473929 6:26188957-26188979 GCGAGCCAGGCGGCGGATAGCGG + Exonic
1005649464 6:27873391-27873413 CCGTGCCAGGCGTCGGATGGCGG + Exonic
1007237590 6:40401917-40401939 GAGAGCCAGGGGTCGGGTAGGGG - Intronic
1007580925 6:42959610-42959632 GCGAGCCAGCCAGCAGAAAGAGG - Intergenic
1018400421 6:163414945-163414967 CCGAGCCGGGCGGCCGAGAGCGG + Exonic
1026980899 7:74526095-74526117 GTGAGCCAGGCGGAGGTTGGGGG + Intronic
1029381666 7:100219441-100219463 GCGAGCCAGGCTGGGGGTTGTGG + Intronic
1029401827 7:100351889-100351911 GCGAGCCAGGCTGGGGGTTGTGG + Intronic
1035023036 7:155809886-155809908 GCCAGGCAGGCGGCGGACTGGGG + Intronic
1045432196 8:102124345-102124367 GCGAGCCAGGCTGGGGAGGGGGG - Intronic
1046412641 8:113867292-113867314 GGGAGCCAGATGGCAGATAGGGG - Intergenic
1049830905 8:144700261-144700283 GGGAGCCAGGCGGGAGAGAGGGG + Intergenic
1050624675 9:7490173-7490195 GGGAGCCAGACTGCGGATAAAGG - Intergenic
1060106418 9:120876273-120876295 GCGAGCCAGGTGGCAGGGAGAGG - Intronic
1061917700 9:133763767-133763789 GCGAGCCAGGCTCTGGGTAGTGG - Exonic
1062655906 9:137604740-137604762 GCCAGCAAGGAGGGGGATAGCGG + Intergenic
1062659172 9:137619274-137619296 GCGGGCCGGGCGGCGGCTGGGGG + Intronic
1190411266 X:50139389-50139411 GAGAGCCAGGCAGAGGATCGGGG + Intergenic
1199679391 X:150214877-150214899 GCGAGCTCGGCGGCGGGGAGGGG + Intergenic
1199695836 X:150342172-150342194 GCGAGCTCGGCGGCGGGGAGGGG - Intergenic