ID: 1005473930

View in Genome Browser
Species Human (GRCh38)
Location 6:26188958-26188980
Sequence CGAGCCAGGCGGCGGATAGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 48}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005473922_1005473930 4 Left 1005473922 6:26188931-26188953 CCAGAAATACGCTTGACGCCGCC 0: 1
1: 0
2: 4
3: 7
4: 15
Right 1005473930 6:26188958-26188980 CGAGCCAGGCGGCGGATAGCGGG 0: 1
1: 0
2: 1
3: 6
4: 48
1005473919_1005473930 28 Left 1005473919 6:26188907-26188929 CCGCGAGTTTCCTCATAAATGAG 0: 1
1: 0
2: 1
3: 15
4: 99
Right 1005473930 6:26188958-26188980 CGAGCCAGGCGGCGGATAGCGGG 0: 1
1: 0
2: 1
3: 6
4: 48
1005473921_1005473930 18 Left 1005473921 6:26188917-26188939 CCTCATAAATGAGGCCAGAAATA 0: 1
1: 0
2: 3
3: 28
4: 292
Right 1005473930 6:26188958-26188980 CGAGCCAGGCGGCGGATAGCGGG 0: 1
1: 0
2: 1
3: 6
4: 48

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005473930 Original CRISPR CGAGCCAGGCGGCGGATAGC GGG Exonic
904941400 1:34166616-34166638 CGAGCCAGGCTGGGGGTGGCTGG + Intergenic
910760810 1:90729583-90729605 CCAGCCAGGCGGGGGACTGCGGG + Intergenic
915319895 1:155051006-155051028 CGAGCCAGGCCGCGCACAGGAGG + Intronic
1068544962 10:58335063-58335085 CGAGCCAGGGAGCGGCTAACCGG + Exonic
1083811375 11:65108623-65108645 CGAGCCCGGCAGCGGCCAGCAGG - Exonic
1122105699 14:99452828-99452850 CGAGCCAGCAGGCAGATCGCGGG + Intronic
1122418425 14:101561137-101561159 GGAGCCAGGCGGCGGGGACCAGG + Intergenic
1124789906 15:32717883-32717905 CGGGAAAGGGGGCGGATAGCGGG + Intergenic
1128264315 15:66253714-66253736 GGAGCCGGGCGGCGGGCAGCGGG + Exonic
1129516842 15:76162217-76162239 GGAGCCAGGCCGCCGGTAGCAGG + Intronic
1132527666 16:425738-425760 GGATCCGGGCGGCGGATGGCGGG - Exonic
1132553703 16:563857-563879 TGGGGCAGGCGGGGGATAGCAGG - Exonic
1141406367 16:83797174-83797196 CCAGTCAGGCGGCTGGTAGCCGG + Intronic
1141595133 16:85092757-85092779 CGAGCCAGGCGGGGTGCAGCTGG - Exonic
1142139144 16:88464896-88464918 CGAGATAGGCAGCGGATCGCTGG - Intronic
1142374689 16:89701006-89701028 CGAGCCAGGCCGCGTAGCGCGGG + Exonic
1155110795 18:22712480-22712502 GGAGCCAGGCTGAGCATAGCAGG + Intergenic
1158529662 18:58247607-58247629 CGAACCAGGAGGCGGGCAGCAGG - Intronic
1161136439 19:2622665-2622687 CGAGCAACGCGGCAGATAGGGGG + Intronic
1161979892 19:7624875-7624897 CGAGCCAGGTGGAGGACAGGCGG - Intronic
1165648873 19:37468795-37468817 CGTGCCAGGCTGAGGGTAGCGGG + Intronic
932616464 2:73234525-73234547 CGAGCCAGGCCGCGGCTGGCTGG - Intronic
941218247 2:162740170-162740192 CGAGCCAGGAGGTGGACACCAGG + Intronic
942653802 2:178194598-178194620 GGAGGCAGGAGGCGGAGAGCCGG - Exonic
947792503 2:232876199-232876221 CCGGCCAGGCGGGGGCTAGCAGG + Intronic
1168886837 20:1266229-1266251 CCAGCCAGTCGGCGGCTCGCCGG - Intronic
1170875641 20:20247456-20247478 AGAGCAAGGCTGCGGAAAGCTGG + Intronic
1176373653 21:6076894-6076916 CAAGCCATGCGGCGGAACGCTGG - Intergenic
1179749824 21:43461349-43461371 CAAGCCATGCGGCGGAACGCTGG + Intergenic
1179955988 21:44738892-44738914 CCAGCCAGGCAGCTGTTAGCAGG + Intergenic
1184796916 22:46738143-46738165 CGAGCCCGGCGGCGGAGATGGGG - Exonic
950651993 3:14413064-14413086 CTAGCCAGGCTGCTGACAGCAGG + Intronic
954689813 3:52389671-52389693 CGAGCCAGGCCCTGGAAAGCAGG - Intronic
968485356 4:858360-858382 CGAGCCAGCAGGCGGAGGGCTGG + Intronic
969330359 4:6471066-6471088 TGGGCCAGGCGGCGGAGACCGGG - Intronic
984155816 4:176195278-176195300 CCTGGCAGGCGGCGGAAAGCAGG + Intronic
997361713 5:133299455-133299477 CTAACCAGGCGGCGGCTGGCAGG + Intronic
1005456180 6:26021775-26021797 CGGGCCAGACGCCGGATGGCCGG - Exonic
1005464972 6:26104044-26104066 CGAGCCAAACGGCGAATAGCCGG - Exonic
1005473930 6:26188958-26188980 CGAGCCAGGCGGCGGATAGCGGG + Exonic
1005475611 6:26204741-26204763 CGAGCAAGGCGCCGGATGGCAGG - Exonic
1005479315 6:26240522-26240544 CGGGCCAAGCGACGGATGGCGGG - Exonic
1005484329 6:26285381-26285403 CGAGCAAGGCGCCGGATAGCTGG + Exonic
1005570355 6:27139405-27139427 CGAGCAAGGCGCCGAATGGCTGG - Exonic
1005643987 6:27824221-27824243 CGAGCAAGGCGCCGGATGGCCGG - Exonic
1005645210 6:27831409-27831431 CGAGCAAGGCGCCGGATGGCCGG + Exonic
1005649465 6:27873392-27873414 CGTGCCAGGCGTCGGATGGCGGG + Exonic
1017164020 6:151391102-151391124 GGAGCCAGGCGGCGGCGAGTCGG - Intronic
1030884783 7:114923090-114923112 CGAGGCGGGCGGCGGCCAGCTGG + Exonic
1032193778 7:129778776-129778798 CGAGCCAGGTGGCGGATTCTCGG - Intergenic
1050191691 9:3033254-3033276 ATAGCCAGGAGGCAGATAGCAGG + Intergenic
1051602135 9:18885837-18885859 CGGTCCAGGCGTCGGATAGAAGG + Intronic
1062655908 9:137604741-137604763 CCAGCAAGGAGGGGGATAGCGGG + Intergenic
1185464462 X:346420-346442 CGCCCCAGGCCGCGGAAAGCGGG + Intronic
1187768090 X:22665229-22665251 CAAGCCAGAAGGCGGACAGCAGG - Intergenic
1196937208 X:120741876-120741898 GGAGCCAGGCTGGGGATTGCAGG + Intergenic