ID: 1005473932

View in Genome Browser
Species Human (GRCh38)
Location 6:26188963-26188985
Sequence CAGGCGGCGGATAGCGGGCT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 80}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005473921_1005473932 23 Left 1005473921 6:26188917-26188939 CCTCATAAATGAGGCCAGAAATA 0: 1
1: 0
2: 3
3: 28
4: 292
Right 1005473932 6:26188963-26188985 CAGGCGGCGGATAGCGGGCTTGG 0: 1
1: 0
2: 1
3: 6
4: 80
1005473922_1005473932 9 Left 1005473922 6:26188931-26188953 CCAGAAATACGCTTGACGCCGCC 0: 1
1: 0
2: 4
3: 7
4: 15
Right 1005473932 6:26188963-26188985 CAGGCGGCGGATAGCGGGCTTGG 0: 1
1: 0
2: 1
3: 6
4: 80
1005473926_1005473932 -9 Left 1005473926 6:26188949-26188971 CCGCCGCGGCGAGCCAGGCGGCG 0: 1
1: 0
2: 3
3: 12
4: 120
Right 1005473932 6:26188963-26188985 CAGGCGGCGGATAGCGGGCTTGG 0: 1
1: 0
2: 1
3: 6
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005473932 Original CRISPR CAGGCGGCGGATAGCGGGCT TGG Exonic
900198118 1:1387733-1387755 CAGGAGGCCGATACCGGGGTGGG - Intronic
900633381 1:3650633-3650655 CAGGCGGCAGGTAGAGGGGTCGG - Intronic
900943194 1:5814407-5814429 CAGGGGGCGGGTGGCAGGCTGGG + Intergenic
902950952 1:19882526-19882548 CAGGCGGCGAAGAGCCGGCCGGG + Exonic
908648826 1:66309990-66310012 CAGGCTGATGATAGCAGGCTTGG + Intronic
914197348 1:145454448-145454470 CCGGCGGCGGAGAGCGGGCCCGG - Intergenic
915358914 1:155273678-155273700 GAGGCGGGGCATAGCGGGCCTGG - Intronic
920061447 1:203229587-203229609 GAGCCGTCGGATAGTGGGCTGGG - Intronic
1069912185 10:71766355-71766377 CAGGTGGCGGGTGGCGGGCGGGG - Intronic
1075119228 10:119651904-119651926 CAGGCGGCGGGGAGTGGGCTGGG + Intronic
1076655390 10:132020162-132020184 CAGGCAGAGGATAGAGGACTTGG - Intergenic
1076732455 10:132445523-132445545 CAGGAGGCTGAGGGCGGGCTGGG + Intronic
1077107722 11:849324-849346 CCGGCGGCGGGTGGGGGGCTGGG - Intronic
1082811653 11:57482498-57482520 GAGGCGGCGGGAAACGGGCTCGG - Intergenic
1084072337 11:66744640-66744662 CCGGCGGCGGTTCGCGGTCTCGG + Intronic
1084636853 11:70398606-70398628 CAGGCGGCGGTGAGCGAGCGCGG + Exonic
1091313928 11:134597492-134597514 CAGGCGCGGGAGGGCGGGCTGGG + Intergenic
1098426055 12:70366511-70366533 CAGGCGGCGGCTGGGGGGCTGGG + Exonic
1106534597 13:30628535-30628557 CTGTCGGCGGGTAGGGGGCTAGG - Intronic
1113200908 13:107867053-107867075 CTGGCAGGGGAGAGCGGGCTGGG - Intergenic
1124588799 15:31035502-31035524 CAGTCAGCGGTTAGTGGGCTGGG + Intronic
1124789907 15:32717888-32717910 AAGGGGGCGGATAGCGGGTCTGG + Intergenic
1126703411 15:51386683-51386705 TAGGCGGGGGACAGCGGGCGGGG + Intronic
1132669614 16:1097200-1097222 CAGGCTGCGGGCAACGGGCTGGG + Intergenic
1136188294 16:28600886-28600908 CAGGCGGCGGCAGGCGGGCAAGG - Intergenic
1136190766 16:28613880-28613902 CAGGCGGCGGCAGGCGGGCAAGG - Intronic
1137708213 16:50549288-50549310 CAGGAGGGGGTTCGCGGGCTGGG - Intronic
1140224567 16:73067226-73067248 CAGGCTGCGGAAAGAGGGGTCGG - Intergenic
1141959158 16:87392722-87392744 CAGCCGGCGGAGGGCGGGCGGGG + Intronic
1142251194 16:88992829-88992851 CAGGCAGCTGATGGGGGGCTGGG - Intergenic
1146787474 17:35732086-35732108 CTGGAGGCGGAGAGCGAGCTGGG + Intronic
1148579002 17:48730061-48730083 CAGGAGGCAGATAGGGGTCTTGG - Intergenic
1151539569 17:74758219-74758241 CAGGGAGCGGATGGCGGGCACGG - Intronic
1152303447 17:79508382-79508404 CAGGCGGAGGAGGTCGGGCTGGG - Intronic
1152697424 17:81804087-81804109 GCGGCGGCGGAGGGCGGGCTCGG - Intergenic
1160224328 18:77000651-77000673 CAGGCGGCGGGCAGCAGCCTGGG - Intronic
1160452957 18:78978474-78978496 CAGGCGGAAGAACGCGGGCTGGG + Intergenic
1160668582 19:344888-344910 GAGGGGGCGGAGAGCGGGCCGGG + Intergenic
1160730791 19:640828-640850 CAGGCGGCAGCCAGCGGGCCCGG - Intronic
1165213704 19:34254638-34254660 CAGGCGGGGGCTGGCGGGCGGGG + Intronic
1165349173 19:35267259-35267281 CAGGCGGGGGCTGGCGGGCCAGG + Exonic
1166000966 19:39877203-39877225 CAGGGGACGGACAGCTGGCTGGG + Exonic
1168343939 19:55641386-55641408 CAGGCGGTGTGTAGCGGGATGGG + Intronic
927517733 2:23681972-23681994 GAGGCGGTGGATAGAGGCCTGGG - Intronic
929936344 2:46297105-46297127 TGGGCGGCGGGTAGCGGGGTGGG - Intronic
931698111 2:64887294-64887316 CAGGGGGCGGATAGTGTGCGTGG + Intergenic
937146328 2:119648189-119648211 CAAGTGTCAGATAGCGGGCTAGG - Intronic
1173279782 20:41618120-41618142 CAGGCGGCGGCCTGCGGCCTGGG - Intronic
1176046664 20:63096491-63096513 CAGGCAGCGGGCAGCAGGCTGGG - Intergenic
1183201407 22:36387752-36387774 CAGGCGGCGGCGGGCGGGCGGGG - Intronic
1184698049 22:46150631-46150653 CAGGCGGCGGACCGCGGCCCAGG + Intronic
1185143997 22:49119568-49119590 CAGGCCGCTGAAAGCGGGCTTGG - Intergenic
1185255276 22:49828006-49828028 GAGGCGGCGGGGACCGGGCTGGG + Intergenic
1185315719 22:50178357-50178379 CAGGCGGAGGACTGTGGGCTAGG + Exonic
955361122 3:58275790-58275812 CAGGCAGGGGGTAGGGGGCTGGG - Intronic
959666046 3:108922819-108922841 CTGTCGGCGGGTAGGGGGCTAGG - Intronic
961452731 3:127009672-127009694 CAGGGGGCGGATGGTGGCCTTGG - Intronic
968965557 4:3767518-3767540 CGGGCGGCGGCGAGCGGGCGCGG + Exonic
969652545 4:8476332-8476354 CAGGCGTCGGACAGCGCCCTGGG - Exonic
976928037 4:90526546-90526568 CAGGTGGGGGATGGTGGGCTAGG - Intronic
983514497 4:168641919-168641941 CAGGAGGCGGATAGATGACTAGG + Intronic
984155819 4:176195283-176195305 CAGGCGGCGGAAAGCAGGCGGGG + Intronic
990954664 5:61330997-61331019 CAGGCGGCGGACGGCGGCTTCGG - Intergenic
995935063 5:117501162-117501184 CAGGTGGCAGATAGCAGGGTGGG - Intergenic
1005456178 6:26021770-26021792 CAGACGCCGGATGGCCGGCTTGG - Exonic
1005473932 6:26188963-26188985 CAGGCGGCGGATAGCGGGCTTGG + Exonic
1005475610 6:26204736-26204758 AAGGCGCCGGATGGCAGGCTTGG - Exonic
1005643986 6:27824216-27824238 AAGGCGCCGGATGGCCGGCTTGG - Exonic
1005645211 6:27831414-27831436 AAGGCGCCGGATGGCCGGCTTGG + Exonic
1005649467 6:27873397-27873419 CAGGCGTCGGATGGCGGGCTTGG + Exonic
1014315829 6:119863473-119863495 CAGGAGGAGGCTATCGGGCTTGG - Intergenic
1014952393 6:127572171-127572193 CTGTCGGCGGGTAGAGGGCTAGG - Intronic
1019427233 7:983457-983479 CAGGCAGTGGAAACCGGGCTGGG - Intronic
1022207773 7:28180274-28180296 CGGGGGGCGGGGAGCGGGCTCGG - Intronic
1028288439 7:89034397-89034419 CTGGCGGGGGGTAGGGGGCTAGG - Intronic
1036178175 8:6559278-6559300 CAGGGTGGGGCTAGCGGGCTGGG + Intronic
1037281372 8:17246522-17246544 CTGGCGGCGGGTTGGGGGCTGGG - Intronic
1040319725 8:46286496-46286518 CAGGTGGGGGATAGAGGCCTGGG - Intergenic
1051603588 9:18897880-18897902 CAGACGGTGGATAGTAGGCTGGG + Intronic
1051619431 9:19036099-19036121 CTGGCGGGGGGTAGGGGGCTGGG + Intronic
1062581287 9:137230320-137230342 CAGCAGGCTGCTAGCGGGCTCGG - Intergenic
1062696334 9:137877977-137877999 CCGGCGGCGGAGAGCGGGCCCGG + Exonic
1202800808 9_KI270719v1_random:174383-174405 CAGGCGGCGGAGCGTGGTCTGGG - Intergenic
1185464468 X:346425-346447 CAGGCCGCGGAAAGCGGGGAGGG + Intronic
1185505619 X:630725-630747 CAGGCAGCGCATGGGGGGCTGGG + Exonic
1186067582 X:5782842-5782864 CTGTCGGGGGATAGGGGGCTGGG - Intergenic
1197625026 X:128792181-128792203 CTGTCGGGGGATAGGGGGCTAGG + Intergenic
1199997077 X:153032183-153032205 CAGGCAGGGGACAGCAGGCTGGG + Intergenic