ID: 1005473933

View in Genome Browser
Species Human (GRCh38)
Location 6:26188974-26188996
Sequence TAGCGGGCTTGGTGATTCCT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 47
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 45}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005473926_1005473933 2 Left 1005473926 6:26188949-26188971 CCGCCGCGGCGAGCCAGGCGGCG 0: 1
1: 0
2: 3
3: 12
4: 120
Right 1005473933 6:26188974-26188996 TAGCGGGCTTGGTGATTCCTTGG 0: 1
1: 0
2: 0
3: 1
4: 45
1005473922_1005473933 20 Left 1005473922 6:26188931-26188953 CCAGAAATACGCTTGACGCCGCC 0: 1
1: 0
2: 4
3: 7
4: 15
Right 1005473933 6:26188974-26188996 TAGCGGGCTTGGTGATTCCTTGG 0: 1
1: 0
2: 0
3: 1
4: 45
1005473928_1005473933 -1 Left 1005473928 6:26188952-26188974 CCGCGGCGAGCCAGGCGGCGGAT 0: 1
1: 0
2: 2
3: 8
4: 52
Right 1005473933 6:26188974-26188996 TAGCGGGCTTGGTGATTCCTTGG 0: 1
1: 0
2: 0
3: 1
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005473933 Original CRISPR TAGCGGGCTTGGTGATTCCT TGG Exonic
901493687 1:9609373-9609395 CAGCGTGGTTGGTGATCCCTGGG + Intronic
901647497 1:10724560-10724582 CTGAGGGCTAGGTGATTCCTGGG - Intronic
906060729 1:42946827-42946849 TAGCCGGCTTGATCATTGCTGGG + Intronic
918318519 1:183343181-183343203 TACACGGCTTGGTGATTGCTTGG - Intronic
923627182 1:235623560-235623582 TAGCGGGCTTGCTCCATCCTGGG + Intronic
1064263800 10:13808448-13808470 GCTCTGGCTTGGTGATTCCTAGG - Intronic
1078668229 11:13343329-13343351 TAGGGGGATTGATGGTTCCTGGG + Intronic
1100934535 12:99648093-99648115 TAGCGGGCATCCTGTTTCCTTGG - Exonic
1113246099 13:108397453-108397475 GAATGGGATTGGTGATTCCTGGG + Intergenic
1116629795 14:47315666-47315688 TAATGAGCTTGGTCATTCCTTGG - Intronic
1129201240 15:74002213-74002235 TAGCGGCCTAGGATATTCCTTGG + Intronic
1137447493 16:48540585-48540607 TGAGGGGCTGGGTGATTCCTGGG - Exonic
1138165748 16:54800149-54800171 CAGCGGCATTGGTGATACCTGGG - Intergenic
1143296717 17:5876755-5876777 TACAGGACTTGGTGATTTCTTGG - Intronic
1152286930 17:79418067-79418089 AAGGGGGCTTCGTGTTTCCTGGG + Intronic
1153321174 18:3775517-3775539 AAGCGTGCTTGGTGAGGCCTCGG - Intronic
1158102350 18:53843303-53843325 TAGAGGGCTGGGTGATTCATAGG + Intergenic
1160365250 18:78319185-78319207 ACACAGGCTTGGTGATTCCTTGG + Intergenic
1160915719 19:1495643-1495665 CATGGGGCTTGGGGATTCCTGGG + Intronic
1165883488 19:39060291-39060313 TAGCTGTCTGTGTGATTCCTGGG + Intergenic
1168136279 19:54354174-54354196 CAGCAGGCTCAGTGATTCCTTGG + Exonic
935350463 2:102147990-102148012 TGCCAGGCTTGGTGTTTCCTGGG + Intronic
935884381 2:107599872-107599894 TAGAGAGGTTGGTGATACCTAGG - Intergenic
1172504367 20:35450531-35450553 TAGCTGGCTTAGTGCTTTCTGGG + Intronic
969353567 4:6612336-6612358 TAGAGGGCCTGGTGTTTCGTGGG + Intronic
972496341 4:39638597-39638619 TCTCGGGCTTGGCGTTTCCTCGG - Intronic
973561920 4:52145349-52145371 TCGGGGGCTTGGAGATTCTTGGG + Intergenic
984262088 4:177454086-177454108 TACAGGGCTTGGTGATGGCTTGG + Intergenic
986595707 5:9419651-9419673 TAGGGGGCTTTATGTTTCCTAGG + Intronic
999194487 5:149772835-149772857 TGGCGGTGGTGGTGATTCCTCGG + Intronic
1002935901 6:1672124-1672146 TAGTTGTCTTGGTGATTACTGGG - Intronic
1005456176 6:26021759-26021781 TGGCCGGCTTGGTGATGCCCTGG - Exonic
1005456733 6:26027150-26027172 TGGCCGGTTTGGTGATGCCTTGG + Exonic
1005473933 6:26188974-26188996 TAGCGGGCTTGGTGATTCCTTGG + Exonic
1005484331 6:26285397-26285419 TAGCTGGCTTAGTGATGCCCTGG + Exonic
1005570352 6:27139389-27139411 TGGCTGGCTTGGTGATACCCTGG - Exonic
1005643984 6:27824205-27824227 TGGCCGGCTTGGTGATGCCCTGG - Exonic
1005645213 6:27831425-27831447 TGGCCGGCTTGGTGATGCCCTGG + Exonic
1012593066 6:101006357-101006379 TAGCAAGCTTGGGTATTCCTTGG - Intergenic
1017734249 6:157346597-157346619 TAGGGGGCTGTGTAATTCCTTGG - Intergenic
1019985164 7:4650343-4650365 ATGCTGGCTTGGTGCTTCCTTGG - Intergenic
1027001469 7:74657520-74657542 TAGCCGGCGCGGTGCTTCCTGGG + Intergenic
1031324244 7:120372101-120372123 TAGTGGGATTGCTGATTCTTTGG + Intronic
1050377094 9:4984929-4984951 GAGCGCGCGTGGAGATTCCTGGG - Intergenic
1198514118 X:137387210-137387232 TAGAGGGCTTGGAGATTGCATGG + Intergenic
1198534107 X:137569544-137569566 AAACGGGCTTGGTGAAACCTGGG + Intronic
1200080097 X:153572034-153572056 TGCTGGGCTTGGTGATTGCTTGG - Intronic