ID: 1005475608

View in Genome Browser
Species Human (GRCh38)
Location 6:26204725-26204747
Sequence TGGCAGGCTTGGTAATGCCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 4, 3: 7, 4: 165}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005475608_1005475617 2 Left 1005475608 6:26204725-26204747 CCAGGGCATTACCAAGCCTGCCA 0: 1
1: 0
2: 4
3: 7
4: 165
Right 1005475617 6:26204750-26204772 CGGCGCCTTGCTCGTCGCGGGGG 0: 2
1: 3
2: 0
3: 7
4: 52
1005475608_1005475616 1 Left 1005475608 6:26204725-26204747 CCAGGGCATTACCAAGCCTGCCA 0: 1
1: 0
2: 4
3: 7
4: 165
Right 1005475616 6:26204749-26204771 CCGGCGCCTTGCTCGTCGCGGGG 0: 1
1: 0
2: 0
3: 3
4: 23
1005475608_1005475613 -1 Left 1005475608 6:26204725-26204747 CCAGGGCATTACCAAGCCTGCCA 0: 1
1: 0
2: 4
3: 7
4: 165
Right 1005475613 6:26204747-26204769 ATCCGGCGCCTTGCTCGTCGCGG 0: 2
1: 2
2: 1
3: 2
4: 19
1005475608_1005475619 20 Left 1005475608 6:26204725-26204747 CCAGGGCATTACCAAGCCTGCCA 0: 1
1: 0
2: 4
3: 7
4: 165
Right 1005475619 6:26204768-26204790 GGGGGTGTCAAGCGCATTTCTGG 0: 1
1: 1
2: 2
3: 9
4: 63
1005475608_1005475614 0 Left 1005475608 6:26204725-26204747 CCAGGGCATTACCAAGCCTGCCA 0: 1
1: 0
2: 4
3: 7
4: 165
Right 1005475614 6:26204748-26204770 TCCGGCGCCTTGCTCGTCGCGGG 0: 1
1: 0
2: 0
3: 0
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005475608 Original CRISPR TGGCAGGCTTGGTAATGCCC TGG (reversed) Exonic
900035089 1:401168-401190 GGGCATGCTTGGTGTTGCCCAGG - Intergenic
900056708 1:636921-636943 GGGCACGCTTGGTGTTGCCCAGG - Intergenic
901668810 1:10842114-10842136 GGGCAGGCTTGGTGATGAGCAGG - Intergenic
902259312 1:15212628-15212650 TGGCAGCCTTAGGAATGCACCGG - Intronic
904507078 1:30966060-30966082 TGGCAGGCTGGGCAGAGCCCTGG + Exonic
905026369 1:34852871-34852893 CTGCAGGCTTGGTAATGCCCAGG + Exonic
907146587 1:52239105-52239127 TGGCAGGCTTGCTACTACCTTGG - Exonic
907994738 1:59618589-59618611 TGGCAGGCTTTGTAAGGCCATGG + Intronic
912579436 1:110706659-110706681 TGGCATTCTTGGGAATGCCAGGG - Intergenic
912734138 1:112135030-112135052 TGGCTCACTTGGGAATGCCCAGG - Intergenic
913311672 1:117503227-117503249 TGGAAGGCTTCGTAATACACAGG + Intronic
920062540 1:203237653-203237675 TGGAAGGCTTGCAAATTCCCTGG - Intronic
922503289 1:226111858-226111880 TGCCAGGCTTGGTGATGCAGTGG + Intergenic
924158744 1:241208335-241208357 CGCCAGGCTTAGTAATGCACAGG + Intronic
924338811 1:243009503-243009525 GGGCACGCTTGGTGTTGCCCAGG - Intergenic
1064167732 10:13001362-13001384 TGGCCGGCGTGGTACTGCCAGGG + Exonic
1064252679 10:13718750-13718772 TGGGAGGCTTGGGATAGCCCTGG - Intronic
1066229131 10:33414760-33414782 TGGGAGGCTTGTTTAAGCCCAGG + Intergenic
1066375709 10:34856221-34856243 TGGCAGGATTGCTTGTGCCCAGG + Intergenic
1067793379 10:49303982-49304004 TGGGAGGCTTAGGAATTCCCAGG + Intronic
1069422580 10:68260523-68260545 TGGCAGCTGTGCTAATGCCCTGG + Intergenic
1070969253 10:80549901-80549923 TGGCAGGCATGGGCATCCCCAGG + Intronic
1073449508 10:103601304-103601326 TGGTAGGCGTGGCAATGCCCAGG + Exonic
1075096399 10:119474326-119474348 TGAGAGGCTTGGGGATGCCCAGG - Intergenic
1075640303 10:124060007-124060029 TGGCAGGCTTAGTAAGGGCTGGG - Intronic
1078132610 11:8625082-8625104 CAGCAGGCTTGGTACTGCCTGGG + Exonic
1081809251 11:45906035-45906057 TGGCAGGGGAGGTAAGGCCCAGG - Exonic
1083266775 11:61550532-61550554 TGGCAGGCTTGGTCCAGGCCAGG + Intronic
1084024373 11:66438659-66438681 GGGCAGGCCTGGCCATGCCCGGG - Exonic
1084913030 11:72406635-72406657 TGGCAGGTTGGCTAATACCCAGG + Intronic
1085395131 11:76203369-76203391 TGGCAGGTGTGGGACTGCCCAGG + Intronic
1085739377 11:79065758-79065780 GGGCAGGCCTGGCAATGCCTAGG + Intronic
1090435821 11:126685595-126685617 GGGCAGGCTTGGCACTTCCCAGG + Intronic
1092371866 12:7923259-7923281 TGGGAGGATTGCTTATGCCCAGG - Intronic
1093077278 12:14770982-14771004 TCGCCGGCTTTGTAATGCCTTGG + Exonic
1093798166 12:23338588-23338610 TGACAGGCTTGCTAAGCCCCAGG - Intergenic
1096091898 12:48907728-48907750 TGACATTCTTGGTCATGCCCTGG + Intronic
1096976269 12:55700763-55700785 TGGAAGGCATGGCAGTGCCCTGG + Intronic
1097804695 12:63952421-63952443 TGGGAGGCTTGCTTGTGCCCAGG + Intronic
1102364504 12:112320240-112320262 TGGGAGGATTGCTAAAGCCCGGG + Intronic
1103232471 12:119343316-119343338 TTGCAAGCTTGGAAATGCCTCGG + Intronic
1103709399 12:122900143-122900165 TGGGAGGATTGGTGAGGCCCAGG + Intergenic
1104570815 12:129924293-129924315 TGGCTGGCTTGTAAATGCTCAGG - Intergenic
1106523246 13:30517156-30517178 TGGAAGGCTTGGTAAAGTACAGG + Intronic
1108997723 13:56756034-56756056 TGGCAGGCTTGCTTGAGCCCAGG - Intergenic
1111622889 13:90747042-90747064 TGGCAGCCATGGAAATGCACAGG + Intergenic
1113458706 13:110467055-110467077 TGGCAGGCCTGGCAATCCCTTGG - Exonic
1122742906 14:103882103-103882125 GGGCAGGCTTGGAAATAACCTGG - Intergenic
1123148115 14:106153879-106153901 GGGGAGGCTTGGTAAAGCCTGGG - Intergenic
1123207635 14:106728411-106728433 GGGGAGGCTTGGTAAAGCCTGGG - Intergenic
1126778245 15:52117945-52117967 TTCCAGGCTTGGGAATGGCCTGG + Exonic
1128274853 15:66344774-66344796 TGGCAGGATTGCTTAAGCCCTGG + Intronic
1130147018 15:81282167-81282189 TGGCATGCTTGCTTTTGCCCTGG + Intronic
1132150416 15:99454657-99454679 TGTTAGGCTTGGCAATGCCAGGG - Intergenic
1134626757 16:15727876-15727898 TGGCAGGCTTGCTTGAGCCCAGG + Intronic
1137632224 16:49955041-49955063 TGGCAGGCTTGGGGAAGCCTAGG + Intergenic
1138250951 16:55501562-55501584 TGGCATGCTTCCTCATGCCCTGG - Intronic
1139510337 16:67424646-67424668 TCCAAGGCTTTGTAATGCCCCGG - Intergenic
1140882486 16:79211514-79211536 GGGGAGGCCTGCTAATGCCCAGG + Intronic
1141113821 16:81291651-81291673 AGGCAGGCTGGATAATTCCCAGG + Intergenic
1143901553 17:10178300-10178322 TGGAATGCTTGGCAATGCCTTGG + Intronic
1144520766 17:15951062-15951084 TGTCAGGCTACGTCATGCCCGGG + Intronic
1148576676 17:48716820-48716842 TGGCAGGATTGCTTAAGCCCGGG - Intergenic
1151358030 17:73571826-73571848 CTGCAGGCTGGGAAATGCCCAGG - Intronic
1152382344 17:79948615-79948637 GGACAGGCTTGGTGGTGCCCAGG + Intronic
1158440078 18:57467778-57467800 GGGAAGGCTTGGCACTGCCCTGG - Intronic
1160511542 18:79456010-79456032 GGGCAGCCTTGGAAAGGCCCGGG - Intronic
1165479063 19:36051215-36051237 TGGCAGGCATGTTGCTGCCCTGG - Intronic
1165588864 19:36947724-36947746 TGGAAGGGTTGCTAAAGCCCAGG - Intronic
925786847 2:7439864-7439886 TGGGAGGCTTGGTCAAGGCCAGG + Intergenic
928040629 2:27872936-27872958 TGGCAGGGTTGGGAATGAGCAGG + Intronic
931817914 2:65922734-65922756 TGGGAGGATTGCTTATGCCCAGG - Intergenic
935252914 2:101280939-101280961 TGGCAGGATTGGTTAAGCCCAGG + Intronic
937126541 2:119478425-119478447 TGGCAGGCTCCCTAATGGCCTGG - Intronic
937825972 2:126368945-126368967 GGGCAGGCTTCCTAATGCCCTGG - Intergenic
937884298 2:126889558-126889580 TGGCAGGGTTGGAAATGGACAGG - Intergenic
938064341 2:128272991-128273013 TGACAGGCTTGGTCATTCCAGGG - Intronic
939005760 2:136785141-136785163 TGGAAGGCTTGACAATACCCAGG - Intronic
942647135 2:178124719-178124741 TGGCAGGATTGCTTTTGCCCAGG + Intronic
944351571 2:198733737-198733759 TGGAAGGATTGCTTATGCCCAGG + Intergenic
945987727 2:216368932-216368954 TGCCAGACTTGGAAAAGCCCTGG + Intronic
946415958 2:219539768-219539790 TGGAAGGCTTGGAAATGCATGGG + Exonic
1172176164 20:32973033-32973055 AGGAAGGCCTGGAAATGCCCAGG - Intergenic
1172436414 20:34931806-34931828 TGGCAAGGTTGGTGATGCTCTGG - Intronic
1175999674 20:62826208-62826230 TGGCAGTCCTCGTAATCCCCGGG - Exonic
1176246405 20:64099310-64099332 GGACAGGCTTGGCACTGCCCGGG + Exonic
1176686088 21:9849724-9849746 TGGAATGATTGGTAATGGCCTGG - Intergenic
1178517682 21:33262812-33262834 TGGCAGGTTAGGAAATGGCCAGG - Exonic
1179274270 21:39877457-39877479 TGGGAGGATTGGTTAAGCCCAGG + Intronic
1180744254 22:18076781-18076803 TGGGAAGCTTGGCAAAGCCCGGG - Intergenic
1182247573 22:28971797-28971819 TGGGAGGATTGCTTATGCCCAGG - Intronic
1182745900 22:32605304-32605326 TGGCAAGCTTGGGAAGGGCCTGG + Intronic
1183369349 22:37423751-37423773 GGGCAGGCTTGCTTATGCCTGGG - Intronic
1183601181 22:38841448-38841470 TGGCAGGCTTGGACCTGCCTTGG - Intronic
1183640804 22:39091262-39091284 TGGGAGGATTGGTTAAGCCCGGG - Intergenic
952273810 3:31858087-31858109 TGGCAGGATTGCTTAAGCCCAGG - Intronic
952745410 3:36772475-36772497 AGGCAGGCTTGGTAATTCAATGG - Intergenic
954389995 3:50263740-50263762 GGGCAGGCTTGGCAGTGCCAGGG + Intergenic
954813695 3:53263989-53264011 TGGGAGGCTTGTTTAAGCCCAGG + Intergenic
960143251 3:114171738-114171760 TGGCCACCTTGGTGATGCCCTGG - Exonic
960976768 3:123183409-123183431 TGGGAGGGTTGCTTATGCCCAGG - Intronic
961464042 3:127070758-127070780 TGGGAGGATTGGGAATGCCGGGG + Intergenic
961796446 3:129412287-129412309 TGGGAGGATTGCTTATGCCCAGG + Intronic
962677149 3:137765447-137765469 TGCCAGTCTTGGTCATGCCTGGG - Exonic
966396880 3:179513274-179513296 TGGGAGGCTTGCTTAAGCCCAGG - Intergenic
967283145 3:187841880-187841902 TGGCCTGCATGGTAATGCCTGGG + Intergenic
967770375 3:193327883-193327905 TGCCATGCTTGGTAAAGCTCTGG - Intronic
969337877 4:6522341-6522363 AGTGAGGATTGGTAATGCCCGGG - Intronic
972297049 4:37749461-37749483 TGGGAGGATTGCTCATGCCCAGG + Intergenic
972848387 4:43018106-43018128 TGTTAGGCTTGGTAATGACAGGG + Intronic
973115379 4:46451200-46451222 TGGCAGGGCAGCTAATGCCCTGG + Intronic
974464654 4:62239508-62239530 TGGCAGCCTTGCAAATGCTCTGG + Intergenic
975329271 4:73095780-73095802 TGGGAGGATTGCTTATGCCCAGG - Intronic
977199269 4:94096735-94096757 TGGGAGGATTGCTTATGCCCAGG - Intergenic
977422314 4:96817418-96817440 TGGGAGGATTGCTAAAGCCCAGG - Intergenic
980136685 4:128864949-128864971 TGGCAGCCTTGGGAATGACATGG - Intronic
987315066 5:16716456-16716478 TGGAAGGCTCGGTAATGTTCAGG - Intronic
990548696 5:56850696-56850718 GGGGAGGCTGGGTTATGCCCAGG - Intronic
994617687 5:102127014-102127036 TGGCAGGCTTATTAATACACTGG - Intergenic
995468723 5:112478255-112478277 TGACAGGTTTGGTAATGAGCTGG + Intergenic
996851915 5:127962621-127962643 TGGCTGGCTTGCTACTGGCCAGG - Intergenic
998426975 5:142037030-142037052 GGGCAGGCCTGGCCATGCCCGGG - Intergenic
998463254 5:142324592-142324614 AGCCGGGCTTGGCAATGCCCAGG + Intronic
999267230 5:150274826-150274848 TGGCATGCTGGGCCATGCCCAGG + Intronic
999427937 5:151503771-151503793 TAGCAGGCTAGCTAAAGCCCAGG - Intergenic
1001154747 5:169263247-169263269 TGGCAGGATTGTTTAAGCCCAGG + Intronic
1001902335 5:175442860-175442882 TGGCCGTCCTGGTCATGCCCTGG - Exonic
1002738730 5:181417703-181417725 GGGCATGCTTGGTGTTGCCCAGG + Intergenic
1004001937 6:11604096-11604118 TAGTAGGCTTGGTAATGGCCAGG + Intergenic
1005456176 6:26021759-26021781 TGGCCGGCTTGGTGATGCCCTGG - Exonic
1005456733 6:26027150-26027172 TGGCCGGTTTGGTGATGCCTTGG + Exonic
1005464970 6:26104028-26104050 TAGCCGGTTTTGTAATGCCCTGG - Exonic
1005475608 6:26204725-26204747 TGGCAGGCTTGGTAATGCCCTGG - Exonic
1005484331 6:26285397-26285419 TAGCTGGCTTAGTGATGCCCTGG + Exonic
1005570352 6:27139389-27139411 TGGCTGGCTTGGTGATACCCTGG - Exonic
1005643984 6:27824205-27824227 TGGCCGGCTTGGTGATGCCCTGG - Exonic
1005645213 6:27831425-27831447 TGGCCGGCTTGGTGATGCCCTGG + Exonic
1006389974 6:33752431-33752453 TGGCAGGCTCAGGCATGCCCTGG - Intergenic
1008389930 6:50938443-50938465 TGGCACACTTGGTGATGCCATGG + Intergenic
1015881970 6:137878997-137879019 AGGCAGGCTTGGCACTTCCCGGG - Exonic
1018531817 6:164772701-164772723 TGGGAGGATTGGTAAAGGCCAGG + Intergenic
1019243835 6:170693255-170693277 GGGCACGCTTGGTGTTGCCCAGG + Intergenic
1026045557 7:66903639-66903661 TGGCAGCCTTTGTAAACCCCAGG + Intergenic
1027972358 7:85101444-85101466 TGGGAGGCAGGATAATGCCCTGG - Intronic
1028709758 7:93893484-93893506 TGGAAGGATTGGTTAAGCCCAGG + Intronic
1029528366 7:101109156-101109178 TGGCAGGCTGGGTTGTACCCAGG + Intergenic
1030411073 7:109181186-109181208 TGAAAGGCTTGGTAATGCAATGG - Intergenic
1030730989 7:112988800-112988822 TGGAAGGCTTGTTAAAGCACAGG + Intergenic
1032305850 7:130732622-130732644 TGGCAGTCTTGGAAATGTCCAGG - Exonic
1033068217 7:138176636-138176658 TGGGAGGATTGCTAAAGCCCGGG - Intergenic
1034172055 7:149070375-149070397 GAGCAGGATTGGTATTGCCCAGG - Exonic
1034616760 7:152424513-152424535 TGGGAGGATTGGTCAAGCCCAGG - Intronic
1034790954 7:153967471-153967493 AGGCAGGCTTGGTAATTCTACGG - Intronic
1035311091 7:157969523-157969545 TGGCAGGCTGGGTGCTGCCTGGG + Intronic
1035400131 7:158559410-158559432 TGCCAGGCTGGGTATTGGCCTGG - Intronic
1035504288 8:114905-114927 GGGCACGCTTGGTGTTGCCCAGG - Intergenic
1038987242 8:32825161-32825183 TGGCAGGATTGTTAGAGCCCAGG + Intergenic
1040587621 8:48757984-48758006 TGGCCGGGTTTGTCATGCCCGGG + Intergenic
1044561998 8:93621559-93621581 TGCCAGGCTTGGAAGTGCCAAGG - Intergenic
1047762965 8:127967678-127967700 TGGCAGGAGCGGTACTGCCCAGG - Intergenic
1048602290 8:135931111-135931133 TGGGAGACTTAGGAATGCCCTGG + Intergenic
1050775732 9:9257689-9257711 TGGGAGGATTGGTTAAGCCCAGG + Intronic
1053783231 9:41631872-41631894 TGGAATGATTGGTAATGGCCTGG + Intergenic
1054171184 9:61842014-61842036 TGGAATGATTGGTAATGGCCTGG + Intergenic
1054666349 9:67738798-67738820 TGGAATGATTGGTAATGGCCTGG - Intergenic
1055657877 9:78470199-78470221 TGGCAGGTTTGGTCATGACAGGG + Intergenic
1057597437 9:96426916-96426938 TGGGAGGATTGCTTATGCCCGGG - Intergenic
1061920047 9:133777714-133777736 TGGCAGCCCTGGTCATACCCGGG + Intronic
1062254058 9:135612862-135612884 GGTCAGCCTTGGTAATGGCCAGG - Intergenic
1062419522 9:136473134-136473156 TGGCTTGCTGGGTACTGCCCCGG - Intronic
1203604023 Un_KI270748v1:42478-42500 GGGCATGCTTGGTGTTGCCCAGG + Intergenic
1186264030 X:7812218-7812240 GGGAAGGCTTGATAATGTCCAGG - Intergenic
1193147464 X:78092461-78092483 TGCCTGGCTTGGGACTGCCCAGG + Intronic
1194246737 X:91522205-91522227 TGGCAGTCATAGTAGTGCCCTGG + Intergenic
1195058481 X:101170722-101170744 TGGGAGGCTTGTTTGTGCCCAGG - Intergenic
1198746512 X:139896737-139896759 TGGCATGCTTGGGACTACCCAGG - Intronic
1200565701 Y:4763477-4763499 TGGCAGTCATAGTAGTGCCCTGG + Intergenic