ID: 1005475610 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 6:26204736-26204758 |
Sequence | AAGGCGCCGGATGGCAGGCT TGG (reversed) |
Strand | - |
Crispr in exon? | Yes |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 128 | |||
Summary | {0: 1, 1: 2, 2: 1, 3: 9, 4: 115} |
Found 4 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1005475610_1005475616 | -10 | Left | 1005475610 | 6:26204736-26204758 | CCAAGCCTGCCATCCGGCGCCTT | 0: 1 1: 2 2: 1 3: 9 4: 115 |
||
Right | 1005475616 | 6:26204749-26204771 | CCGGCGCCTTGCTCGTCGCGGGG | 0: 1 1: 0 2: 0 3: 3 4: 23 |
||||
1005475610_1005475619 | 9 | Left | 1005475610 | 6:26204736-26204758 | CCAAGCCTGCCATCCGGCGCCTT | 0: 1 1: 2 2: 1 3: 9 4: 115 |
||
Right | 1005475619 | 6:26204768-26204790 | GGGGGTGTCAAGCGCATTTCTGG | 0: 1 1: 1 2: 2 3: 9 4: 63 |
||||
1005475610_1005475620 | 23 | Left | 1005475610 | 6:26204736-26204758 | CCAAGCCTGCCATCCGGCGCCTT | 0: 1 1: 2 2: 1 3: 9 4: 115 |
||
Right | 1005475620 | 6:26204782-26204804 | CATTTCTGGTCTCATCTACGAGG | 0: 2 1: 0 2: 2 3: 17 4: 270 |
||||
1005475610_1005475617 | -9 | Left | 1005475610 | 6:26204736-26204758 | CCAAGCCTGCCATCCGGCGCCTT | 0: 1 1: 2 2: 1 3: 9 4: 115 |
||
Right | 1005475617 | 6:26204750-26204772 | CGGCGCCTTGCTCGTCGCGGGGG | 0: 2 1: 3 2: 0 3: 7 4: 52 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1005475610 | Original CRISPR | AAGGCGCCGGATGGCAGGCT TGG (reversed) | Exonic | ||