ID: 1005475610

View in Genome Browser
Species Human (GRCh38)
Location 6:26204736-26204758
Sequence AAGGCGCCGGATGGCAGGCT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 2, 2: 1, 3: 9, 4: 115}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005475610_1005475617 -9 Left 1005475610 6:26204736-26204758 CCAAGCCTGCCATCCGGCGCCTT 0: 1
1: 2
2: 1
3: 9
4: 115
Right 1005475617 6:26204750-26204772 CGGCGCCTTGCTCGTCGCGGGGG 0: 2
1: 3
2: 0
3: 7
4: 52
1005475610_1005475619 9 Left 1005475610 6:26204736-26204758 CCAAGCCTGCCATCCGGCGCCTT 0: 1
1: 2
2: 1
3: 9
4: 115
Right 1005475619 6:26204768-26204790 GGGGGTGTCAAGCGCATTTCTGG 0: 1
1: 1
2: 2
3: 9
4: 63
1005475610_1005475620 23 Left 1005475610 6:26204736-26204758 CCAAGCCTGCCATCCGGCGCCTT 0: 1
1: 2
2: 1
3: 9
4: 115
Right 1005475620 6:26204782-26204804 CATTTCTGGTCTCATCTACGAGG 0: 2
1: 0
2: 2
3: 17
4: 270
1005475610_1005475616 -10 Left 1005475610 6:26204736-26204758 CCAAGCCTGCCATCCGGCGCCTT 0: 1
1: 2
2: 1
3: 9
4: 115
Right 1005475616 6:26204749-26204771 CCGGCGCCTTGCTCGTCGCGGGG 0: 1
1: 0
2: 0
3: 3
4: 23

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005475610 Original CRISPR AAGGCGCCGGATGGCAGGCT TGG (reversed) Exonic
900604712 1:3518822-3518844 CAGGGCCAGGATGGCAGGCTGGG + Intronic
900943194 1:5814407-5814429 CAGGGGGCGGGTGGCAGGCTGGG + Intergenic
902626632 1:17680294-17680316 AAGGGGCCGGAAGGCTCGCTGGG - Intronic
907000343 1:50846394-50846416 AAGGGGCGGGATGGCAGGGATGG - Intronic
911760298 1:101606352-101606374 AAGCCCCAGGATGGCAGGGTGGG - Intergenic
913250612 1:116909875-116909897 AAAGCGCCGGATGGGAGGCGCGG + Intergenic
914665964 1:149832776-149832798 TAGACGCCGAATGGCAGGCTTGG - Intergenic
914669801 1:149861018-149861040 TAGACGCCGAATGGCAGGCTTGG + Exonic
915245962 1:154556587-154556609 AGGGCTCCACATGGCAGGCTGGG + Intronic
915336537 1:155146283-155146305 AAGGCGCAGGAAGGCTGCCTGGG - Intergenic
917411806 1:174766906-174766928 AAGCCTCCAGATAGCAGGCTTGG - Intronic
921850655 1:219929012-219929034 AAGGCCCCGGAGCACAGGCTTGG + Intronic
923188847 1:231600121-231600143 AAGGTGCCGGATGGAAGGAAAGG - Intronic
1067112357 10:43409263-43409285 GAGCCGCCGGTTGGCCGGCTGGG + Intergenic
1070643376 10:78184859-78184881 AAGCAGCCGGGTGGCAGGCAGGG - Intergenic
1070797684 10:79226372-79226394 AAGGCTCGGGAAGGCAGGCATGG - Intronic
1072759161 10:98041669-98041691 AAGGCCACTGATCGCAGGCTGGG - Intergenic
1075121938 10:119670506-119670528 TAGGCGCCAGAAGGCAGGCCAGG - Intronic
1076695950 10:132247500-132247522 AAGGCGCAGGGTGGCATCCTGGG + Intronic
1076995320 11:294827-294849 CAGGTGAGGGATGGCAGGCTAGG - Exonic
1077098357 11:809635-809657 TAGGCGCCGCGTGGCATGCTGGG + Exonic
1077268665 11:1665009-1665031 GAGGAGCTGGATGGCATGCTGGG + Intergenic
1077272110 11:1686294-1686316 GAGGAGCTGGATGGCATGCTGGG - Intergenic
1077349616 11:2086406-2086428 AAGGCTCAGGATGCCTGGCTTGG - Intergenic
1084215374 11:67644601-67644623 GAGGAGCAGGATGGGAGGCTGGG - Intronic
1084516761 11:69641796-69641818 AGGGTGCGGGCTGGCAGGCTGGG + Intronic
1090395335 11:126414841-126414863 AGGGTGCCGGGTGCCAGGCTGGG - Intronic
1091127507 11:133114246-133114268 AAGGAGCAGGCTGGGAGGCTGGG - Intronic
1091167221 11:133490460-133490482 GAGGCCCAGGATGGCAGGCAAGG + Intronic
1091313928 11:134597492-134597514 CAGGCGCGGGAGGGCGGGCTGGG + Intergenic
1091549820 12:1529324-1529346 AAGGGGCTGGAGGGCAGGCCTGG + Intergenic
1092532923 12:9360267-9360289 AAGGGGTCGGATGGGGGGCTGGG - Intergenic
1095498561 12:42811691-42811713 AGGGCACCGGATGCCATGCTGGG + Intergenic
1096622726 12:52874470-52874492 AAGGGGGCGGAAGGCAGGCCAGG - Intergenic
1104706262 12:130949734-130949756 CAGGAGCCGGAGGGGAGGCTGGG + Intergenic
1106294885 13:28403249-28403271 AGGGCTCCTGATGGCAGGTTGGG + Intronic
1108355448 13:49625456-49625478 AAGGGGCCGGCTGGCAGTCAGGG - Intergenic
1112386310 13:98943152-98943174 AAGGCTCTGGATGGCAGCCCAGG - Intronic
1114683412 14:24506180-24506202 AATGTGCCGGGTGGCTGGCTGGG - Exonic
1123059213 14:105586863-105586885 CAGGCGCCGGATGGAAGCGTGGG + Intergenic
1123083544 14:105707094-105707116 CAGGCGCCGGATGGAAGCGTGGG + Intergenic
1131291570 15:91111275-91111297 AAGGCCCCTGCTGGCTGGCTTGG + Intronic
1132774391 16:1584120-1584142 AGGGCCCCAGATGGCAGGTTAGG - Intronic
1133018288 16:2954981-2955003 AAGGCCCCGGGGGGCAGGCCAGG + Intergenic
1137290544 16:47049349-47049371 AAGGCCCCACATGGCTGGCTCGG - Intergenic
1137840374 16:51635908-51635930 AATGCCCAGGATGGCAGGGTAGG - Intergenic
1147897314 17:43759021-43759043 GAGGTGCCGGAGAGCAGGCTTGG - Intergenic
1151472256 17:74325835-74325857 AGGGCGGCGGCTGGCAGCCTCGG - Intergenic
1151480810 17:74369216-74369238 AAGAGGCAGGATGGCAGGATGGG - Intronic
1152728279 17:81958275-81958297 ACGGGGCCGGATGGCAGGGCAGG - Intronic
1153602140 18:6791233-6791255 AAGACGCAGGCTGGGAGGCTAGG + Intronic
1156446585 18:37241609-37241631 AAGGGGCTGGATGTCAGACTGGG - Intergenic
1158649432 18:59273004-59273026 AAGGAGCGGGATAGGAGGCTGGG - Exonic
1160741241 19:687083-687105 ACGGTGCCGGGTGGCTGGCTGGG - Exonic
1167307180 19:48715853-48715875 AGGGTGCCGGAGGGCAGGCCAGG + Intronic
1167644862 19:50700136-50700158 AAGGCTCGGGTTGGAAGGCTCGG + Intronic
1168189832 19:54729919-54729941 AGGGCGCAGGATGGCAGACAGGG + Intronic
1168201951 19:54821987-54822009 AGGGCGCAGGATGGCAGACAGGG + Intronic
1168513152 19:56989473-56989495 AGAGCGCAGGAAGGCAGGCTCGG - Intergenic
926147707 2:10406711-10406733 AGGGTGCCGGATGCCAGGCGGGG - Intronic
927091766 2:19717829-19717851 AAGGGGCTGGGTGGCAGACTGGG + Intergenic
927709046 2:25313986-25314008 TGGGCGCCGGGAGGCAGGCTGGG + Exonic
928606304 2:32947430-32947452 AAGGCGCCGGCTGCCAGGCCGGG - Exonic
935918656 2:107986340-107986362 AAGGAGCTGGGGGGCAGGCTGGG - Intergenic
937072449 2:119074351-119074373 AAGGTGCTGGAGGTCAGGCTCGG - Intergenic
940014503 2:149089305-149089327 AAGGGGCCAGTTGGCATGCTGGG + Intronic
940481746 2:154241202-154241224 TAGGCACAGGATGGCAGGCCAGG + Intronic
946182877 2:217959574-217959596 AAGGCACCGGGTTCCAGGCTAGG - Intronic
947914399 2:233822240-233822262 CAGGCGCCAGATGTCAGCCTTGG - Exonic
1169774373 20:9236295-9236317 AAGGCGGCGGTTGGCAGGGTTGG - Intronic
1170568623 20:17620682-17620704 ACGGCGCCGGGAGGCAGGCAGGG + Intronic
1171081694 20:22193036-22193058 AAGGCACAGAATGGCAAGCTGGG + Intergenic
1172790370 20:37500724-37500746 AAGGGGCCTGAGGTCAGGCTGGG + Intronic
1176122242 20:63459143-63459165 AAGGAACCTGAGGGCAGGCTCGG + Intronic
1177030033 21:15971006-15971028 AAGGCGTAGGCTGGGAGGCTAGG - Intergenic
1182198031 22:28539226-28539248 AAGGCGGGGGCTGACAGGCTGGG + Intronic
1183298070 22:37043762-37043784 AAGGAGCTGGAGGACAGGCTGGG + Intergenic
1183439386 22:37814863-37814885 AAGGTCCCAGAGGGCAGGCTAGG - Intronic
1185029793 22:48436252-48436274 CAGGCACTGGATGTCAGGCTTGG - Intergenic
949579004 3:5367665-5367687 AAGGTGCAGGCTGGGAGGCTAGG + Intergenic
950119065 3:10469879-10469901 AAGGCGCGAGCTGGGAGGCTTGG - Intronic
950697873 3:14717571-14717593 GAGGCACTGGATGTCAGGCTGGG + Intronic
951498979 3:23362596-23362618 AAGGACCCAGATGGCAGGGTGGG + Intronic
954419753 3:50412551-50412573 AAGGCGCCTGCTGGCCGCCTAGG - Intronic
955058847 3:55479763-55479785 GAGGAGCCAGATGGCAGGATGGG - Intronic
956642398 3:71427479-71427501 AAGGCCCCGGATGCCGGGCTAGG + Intronic
957051532 3:75415767-75415789 CAGGCCCCGGATGGCAGGGATGG + Intergenic
962474622 3:135744317-135744339 AAGGTGCAGGCTGGGAGGCTAGG - Intergenic
967521404 3:190436929-190436951 AATGCTCAGGATGGCAGGATAGG - Intronic
969934104 4:10664477-10664499 AAGGAGCCACATGTCAGGCTGGG - Intronic
972543232 4:40057034-40057056 AAGGCGGCGGGTGGGAGGCAGGG + Intronic
981539161 4:145831134-145831156 AGGACCCCGGATGGCAGGTTAGG + Intronic
982132609 4:152244167-152244189 AAGGCTCCAGATGGCAAACTGGG + Intergenic
985781674 5:1875098-1875120 AAGGCGCCGGGAGGCCGGCAGGG - Intergenic
988891082 5:35617923-35617945 AGGACGCGGGCTGGCAGGCTTGG + Exonic
991289484 5:65018951-65018973 AGGGGGCCAGATGTCAGGCTGGG - Intergenic
1001599262 5:172918589-172918611 CAGGCTCAGGAAGGCAGGCTTGG + Intronic
1003271707 6:4613421-4613443 AAGGAGCAGGATGGGATGCTTGG - Intergenic
1005456178 6:26021770-26021792 CAGACGCCGGATGGCCGGCTTGG - Exonic
1005456731 6:26027139-26027161 AAGGCGCCGAATGGCCGGTTTGG + Exonic
1005473932 6:26188963-26188985 CAGGCGGCGGATAGCGGGCTTGG + Exonic
1005475610 6:26204736-26204758 AAGGCGCCGGATGGCAGGCTTGG - Exonic
1005570354 6:27139400-27139422 AAGGCGCCGAATGGCTGGCTTGG - Exonic
1005643986 6:27824216-27824238 AAGGCGCCGGATGGCCGGCTTGG - Exonic
1005645211 6:27831414-27831436 AAGGCGCCGGATGGCCGGCTTGG + Exonic
1005649467 6:27873397-27873419 CAGGCGTCGGATGGCGGGCTTGG + Exonic
1006945760 6:37783596-37783618 AAGGAGCCGAGGGGCAGGCTGGG - Intergenic
1007094447 6:39204815-39204837 ATGGCCCAGGAGGGCAGGCTGGG - Intronic
1007380733 6:41488632-41488654 CAGGAGCCTGATGGGAGGCTGGG + Intergenic
1007426035 6:41746738-41746760 AACAGGCAGGATGGCAGGCTGGG + Intronic
1015835612 6:137417129-137417151 AAAGTGCAGGGTGGCAGGCTGGG - Intergenic
1016998497 6:149977887-149977909 AAGGGGCCGCATGGGAGACTAGG - Intergenic
1019461356 7:1160524-1160546 GAGGCGCCGGATGGGTCGCTAGG - Intronic
1028626273 7:92880905-92880927 AGGCCCCCGGATGGCATGCTTGG - Intergenic
1028988296 7:97024574-97024596 AAGTCGCCGGATCGGATGCTGGG + Exonic
1029160702 7:98549420-98549442 CAGGGGCCGGATGGCAGGGGTGG - Intergenic
1032097554 7:128947124-128947146 AAGGGGGCTGATGGGAGGCTAGG + Intronic
1036390148 8:8318248-8318270 AAGGCGGTGGATCGCAGGCGGGG - Exonic
1037099905 8:15032489-15032511 CAGGCCCCAGATGCCAGGCTGGG + Intronic
1048299131 8:133238783-133238805 TAGGCGCAGTATGGCAGGCAGGG + Exonic
1056758206 9:89396063-89396085 GAGGTGCCGGATACCAGGCTGGG + Intronic
1057954991 9:99400411-99400433 GAGGCGCAGTATTGCAGGCTGGG - Intergenic
1059722983 9:116979716-116979738 AAGGAGCAGGAAGTCAGGCTGGG + Intronic
1060484333 9:124037599-124037621 AAAGGGCCTGCTGGCAGGCTGGG - Intergenic
1060811939 9:126615068-126615090 ACGGCGCAGGGTGGCCGGCTGGG - Intronic
1062016078 9:134292036-134292058 AAGGGGCAGGAGGGCAGCCTGGG + Intergenic
1190255844 X:48761780-48761802 ATGGCGCAGCATGGCAGGGTAGG - Exonic
1197643474 X:128992716-128992738 TAGGACCTGGATGGCAGGCTTGG + Intergenic