ID: 1005475611

View in Genome Browser
Species Human (GRCh38)
Location 6:26204741-26204763
Sequence CGAGCAAGGCGCCGGATGGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 3, 1: 2, 2: 1, 3: 12, 4: 131}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005475611_1005475620 18 Left 1005475611 6:26204741-26204763 CCTGCCATCCGGCGCCTTGCTCG 0: 3
1: 2
2: 1
3: 12
4: 131
Right 1005475620 6:26204782-26204804 CATTTCTGGTCTCATCTACGAGG 0: 2
1: 0
2: 2
3: 17
4: 270
1005475611_1005475623 30 Left 1005475611 6:26204741-26204763 CCTGCCATCCGGCGCCTTGCTCG 0: 3
1: 2
2: 1
3: 12
4: 131
Right 1005475623 6:26204794-26204816 CATCTACGAGGAGACTCGCGGGG 0: 3
1: 1
2: 0
3: 2
4: 25
1005475611_1005475621 28 Left 1005475611 6:26204741-26204763 CCTGCCATCCGGCGCCTTGCTCG 0: 3
1: 2
2: 1
3: 12
4: 131
Right 1005475621 6:26204792-26204814 CTCATCTACGAGGAGACTCGCGG 0: 3
1: 2
2: 5
3: 3
4: 36
1005475611_1005475619 4 Left 1005475611 6:26204741-26204763 CCTGCCATCCGGCGCCTTGCTCG 0: 3
1: 2
2: 1
3: 12
4: 131
Right 1005475619 6:26204768-26204790 GGGGGTGTCAAGCGCATTTCTGG 0: 1
1: 1
2: 2
3: 9
4: 63
1005475611_1005475622 29 Left 1005475611 6:26204741-26204763 CCTGCCATCCGGCGCCTTGCTCG 0: 3
1: 2
2: 1
3: 12
4: 131
Right 1005475622 6:26204793-26204815 TCATCTACGAGGAGACTCGCGGG 0: 3
1: 1
2: 0
3: 3
4: 19

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005475611 Original CRISPR CGAGCAAGGCGCCGGATGGC AGG (reversed) Exonic
907461829 1:54609741-54609763 CCAGCAAGGCCAGGGATGGCCGG + Exonic
908301111 1:62761697-62761719 CGAGCATGGCGCGGGCAGGCCGG - Intergenic
910034754 1:82776958-82776980 CGAGCACAGCGCCGGTGGGCTGG + Intergenic
912315942 1:108667659-108667681 CGAGCACAGCGCCGGTGGGCTGG - Intergenic
913250611 1:116909870-116909892 CTGGCAAAGCGCCGGATGGGAGG + Intergenic
914203423 1:145506047-145506069 CGAGCACAGCGCCGGTGGGCTGG + Intergenic
914482545 1:148079201-148079223 CGAGCACAGCGCCGGTGGGCTGG + Intergenic
914665965 1:149832781-149832803 CGAGCTAGACGCCGAATGGCAGG - Intergenic
914669800 1:149861013-149861035 CGAGCTAGACGCCGAATGGCAGG + Exonic
918659750 1:187073993-187074015 CGAGCACAGCGCCGGTGGGCTGG + Intergenic
919465633 1:197919705-197919727 TAAGCGAGGCTCCGGATGGCTGG + Intronic
922541899 1:226426469-226426491 CGAGCACAGCGCCGGTGGGCTGG + Intergenic
1075651297 10:124129531-124129553 GGGGCAAGGCTCAGGATGGCAGG + Intergenic
1083583485 11:63839677-63839699 GGAGCCAGGAGCCGGATGACAGG - Intronic
1088399699 11:109409604-109409626 AGAGCAAGGCCCTGGATGGCAGG - Intergenic
1089373559 11:117978664-117978686 CGAGCACAGCGCCGGTGGGCCGG + Intergenic
1089713796 11:120336728-120336750 CGAGCCCGGCGCGGGACGGCCGG + Intergenic
1091233439 11:134003039-134003061 CGAGCACAGCGCCGGTGGGCTGG + Intergenic
1092154686 12:6274534-6274556 GGAGCAAGGCCCAGGATGGGAGG + Intergenic
1093266284 12:17007807-17007829 CGAGCACAGCGCCGGCGGGCTGG - Intergenic
1093580154 12:20777588-20777610 CGAGCACAGCGCCGGTGGGCTGG + Intergenic
1102254088 12:111406150-111406172 CGAGCGAGGAGCCGGCGGGCGGG + Exonic
1102518519 12:113465470-113465492 CGAGAAAGGGGCCGGGCGGCGGG - Intronic
1103146133 12:118597352-118597374 CGAGCACAGCGCCGGTGGGCCGG + Intergenic
1105820827 13:24079258-24079280 CGGACAAGGCCCTGGATGGCTGG - Intronic
1106844612 13:33724965-33724987 CCAGCAAGGCCCCGAATGCCTGG - Intergenic
1108194231 13:47975770-47975792 CGACCAAGGAGCCGCATGGTGGG + Intronic
1108635948 13:52334282-52334304 CGAGCCTGGCGCCGGGGGGCGGG - Intergenic
1108651862 13:52488966-52488988 CGAGCCTGGCGCCGGGGGGCGGG + Intergenic
1112705863 13:102068657-102068679 CGAGCACAGCGCCGGTGGGCTGG - Intronic
1113506649 13:110821343-110821365 CGAGCACAGCGCCGGTGGGCTGG - Intergenic
1113764032 13:112869756-112869778 CCAGCAAGGTGCTGGAGGGCGGG - Intronic
1113917766 13:113884401-113884423 CCAGCAGGGCGCCCGATGGTGGG + Intergenic
1114519138 14:23321840-23321862 CGAGCAGGCCGGCGGCTGGCCGG + Intronic
1117324824 14:54659224-54659246 CGAGCAAGACCCAGGATAGCTGG - Intronic
1119486792 14:74994332-74994354 CGAGCACAGCGCCGGTTGGCCGG - Intergenic
1120229754 14:81829633-81829655 CGAGCACAGCGCCGGCGGGCTGG + Intergenic
1122493446 14:102135688-102135710 CGAGCACAGCGCCGGTGGGCCGG + Intronic
1131291569 15:91111270-91111292 CAAGCAAGGCCCCTGCTGGCTGG + Intronic
1135934962 16:26771756-26771778 AGAGCAAGGAGCAGGATGGAGGG - Intergenic
1144467164 17:15505872-15505894 CGAGCACAGCGCCGGTGGGCTGG - Intronic
1146525354 17:33562812-33562834 CAAGCAAGGGGCTGGATGGGTGG + Intronic
1146740457 17:35279091-35279113 CGAGCACGGCGCTGGTGGGCTGG + Intergenic
1147373635 17:40011118-40011140 CGAGCACAGCGCCGGCGGGCTGG - Intergenic
1152716844 17:81904355-81904377 GGAGCCAGGCGCTGGGTGGCAGG + Exonic
1153805256 18:8705153-8705175 CCTGCACGGCGCCGGCTGGCTGG + Intergenic
1154323855 18:13375821-13375843 AGAGCAAGGCGCTGGCGGGCGGG - Intronic
1158705743 18:59790628-59790650 CGAGCACAGCGCCGGTGGGCTGG + Intergenic
1160332066 18:78003053-78003075 CCTGCAAGGAGCCGTATGGCTGG + Intergenic
1161299093 19:3534320-3534342 GGAGCAAGGTGTCGGGTGGCTGG - Intronic
1164740962 19:30575388-30575410 AGAGCAAGGCTCTGGATGGGAGG - Intronic
1164975808 19:32571772-32571794 CGAGCACCGCGCCGGTGGGCCGG - Intergenic
1166036210 19:40170317-40170339 CGAGCACAGCGCCGGTGGGCTGG + Intergenic
1166487005 19:43222108-43222130 CGAGCACAGCGCCGGTGGGCTGG + Intronic
1166516894 19:43453937-43453959 CTTGCAAGGAGCCCGATGGCTGG - Intergenic
1166852416 19:45767011-45767033 CGGGCAAGGCGCGGGAGGGCCGG + Exonic
927719374 2:25373052-25373074 CGAGCAAGGCCAAGGAGGGCAGG + Intergenic
928606306 2:32947435-32947457 GGGGCAAGGCGCCGGCTGCCAGG - Exonic
928646028 2:33353476-33353498 TGAGCACGGCGCCTGATGGATGG + Intronic
929233722 2:39585539-39585561 CGAGCACAGCGCCGGTGGGCTGG - Intergenic
932486489 2:72087065-72087087 CGAGCACAGCGCCGGTGGGCCGG - Intergenic
932616464 2:73234525-73234547 CGAGCCAGGCCGCGGCTGGCTGG - Intronic
932902060 2:75711758-75711780 CGAGCACAGCGCCGGTGGGCCGG - Intergenic
937378161 2:121352086-121352108 CCAGGAAGGAGCCAGATGGCAGG + Intronic
937746608 2:125422432-125422454 CGAGCACAGCGCCGGCGGGCTGG - Intergenic
937789425 2:125943101-125943123 CGAGCATGGCGCAGGTGGGCCGG + Intergenic
939229769 2:139410524-139410546 CGAGCAAAGCGCCGGTGGGCTGG - Intergenic
941240094 2:163026459-163026481 CGAGCACAGCGCCGGTGGGCTGG - Intergenic
941820802 2:169841717-169841739 CGAGCACAGCGCCGGTGGGCCGG - Intronic
947026641 2:225744317-225744339 CGAGCGAAGCGCCGGTGGGCCGG - Intergenic
1169814444 20:9641765-9641787 CGAGCACAGCGCCGGTGGGCCGG + Intronic
1170246479 20:14226691-14226713 CGAGCACAGCGCCGGTGGGCTGG - Intronic
1171318841 20:24220897-24220919 CGAGCACAGCGCCGGTGGGCTGG + Intergenic
1173195517 20:40910646-40910668 CGAGCACAGCGCCGGTGGGCTGG + Intergenic
1173195698 20:40911367-40911389 CGAGCACAGCGCCGGTGGGCCGG - Intergenic
1173839459 20:46147879-46147901 TGGGCAAGGCACTGGATGGCAGG + Intergenic
1180639780 22:17288967-17288989 GGAGCAAGGCCCCAGATGGGTGG + Intergenic
1183365249 22:37403406-37403428 CGAGCGAGGGGCCGGAGGGTGGG + Intronic
950475764 3:13214024-13214046 AGAGGAAGGAGCCGGGTGGCGGG - Intergenic
956855269 3:73269377-73269399 CGAGCACAGCGCCGGTGGGCCGG - Intergenic
961035601 3:123639464-123639486 CTAGCAAGGAGCCCGAGGGCTGG - Intronic
961042709 3:123688666-123688688 TGAGCAAGGGGCAGGATGGTAGG - Intronic
961356605 3:126343559-126343581 CGAGAAAGGCAGCGGTTGGCGGG + Exonic
962600493 3:136987764-136987786 CTAGCACGGCGCCGGTGGGCTGG + Intronic
965753220 3:171999047-171999069 CGAGCACAGCGCCGGTGGGCCGG + Intergenic
966860925 3:184230513-184230535 CGGGCATGGCGCCGGGAGGCCGG - Exonic
969362366 4:6672908-6672930 CGAGCACAGCGCCGGTGGGCTGG - Intergenic
969654964 4:8491586-8491608 CGAGCACAGCGCCGGTGGGCCGG + Intronic
976520616 4:86021783-86021805 CGAGCACAGCGCCGGTGGGCCGG + Intronic
976646857 4:87396122-87396144 CGAGCACAGCGCCGGTGGGCTGG + Intergenic
979688600 4:123538101-123538123 CGAGCGCGGCGCCGGTGGGCTGG - Intergenic
980051918 4:128047734-128047756 CGAGCACAGCGCCGGTGGGCCGG + Intergenic
980230241 4:130038718-130038740 CGAGCTCGGCGCCGGCGGGCTGG + Intergenic
983553043 4:169036011-169036033 CGAGCACAGCGCCGGTCGGCTGG + Intergenic
984265669 4:177495776-177495798 CGAGCGCAGCGCCGGTTGGCTGG - Intergenic
986698007 5:10375341-10375363 CGAGCACAGCGCCGGTGGGCCGG - Intronic
987146236 5:14993981-14994003 CGAGCACAGCGCCGGCGGGCTGG + Intergenic
989559690 5:42836553-42836575 CGAGCATGGCGCCAGCAGGCCGG - Intronic
990461535 5:56035674-56035696 CGAGCACAGCGCCGGTGGGCCGG - Intergenic
990753022 5:59039048-59039070 CGAGCATGGCGGGGTATGGCAGG - Intronic
995920411 5:117304847-117304869 CGAGCACAGCGCCGGTGGGCGGG - Intergenic
1003581457 6:7344401-7344423 CGAGCACAGCGCCGGTGGGCTGG - Intronic
1005456180 6:26021775-26021797 CGGGCCAGACGCCGGATGGCCGG - Exonic
1005456730 6:26027134-26027156 CTAGCAAGGCGCCGAATGGCCGG + Exonic
1005473930 6:26188958-26188980 CGAGCCAGGCGGCGGATAGCGGG + Exonic
1005475611 6:26204741-26204763 CGAGCAAGGCGCCGGATGGCAGG - Exonic
1005479315 6:26240522-26240544 CGGGCCAAGCGACGGATGGCGGG - Exonic
1005484329 6:26285381-26285403 CGAGCAAGGCGCCGGATAGCTGG + Exonic
1005570355 6:27139405-27139427 CGAGCAAGGCGCCGAATGGCTGG - Exonic
1005643987 6:27824221-27824243 CGAGCAAGGCGCCGGATGGCCGG - Exonic
1005645210 6:27831409-27831431 CGAGCAAGGCGCCGGATGGCCGG + Exonic
1005649465 6:27873392-27873414 CGTGCCAGGCGTCGGATGGCGGG + Exonic
1006352655 6:33532575-33532597 CGAGCACAGCGCCGGTGGGCCGG - Intergenic
1006696023 6:35931455-35931477 CGAGCACAGCGCCGGCGGGCTGG - Intergenic
1008038797 6:46774784-46774806 CGAGCACGGCGCCGGTGGGCTGG - Intergenic
1013080239 6:106805941-106805963 CGAGCACAGCGCCGGTGGGCTGG - Intergenic
1013955330 6:115834775-115834797 CGAGCACAGCGCCGGTGGGCCGG + Intergenic
1016730588 6:147423321-147423343 CGAGCAAGGCGCAGCCTGGAGGG + Intergenic
1017383513 6:153857113-153857135 TGAGCACGGCGCAGGAGGGCTGG + Intergenic
1017537384 6:155363254-155363276 CGAGCACAGCGCCGGTGGGCTGG - Intergenic
1017581207 6:155866930-155866952 CGAGCACAGCGCCGGTGGGCCGG + Intergenic
1017891567 6:158644162-158644184 AGACAAAGGCGCGGGATGGCCGG + Intronic
1023515487 7:40997313-40997335 CCAGCAAGGTGAGGGATGGCAGG - Intergenic
1027561681 7:79739485-79739507 CGAGCACAGCGCCGGTGGGCTGG - Intergenic
1028511209 7:91627568-91627590 CGAGCACAGCGCCGGTGGGCTGG + Intergenic
1029407100 7:100381904-100381926 CGAGCACAGCGCCGGTGGGCTGG - Intronic
1030234940 7:107248288-107248310 GGAACAAGGCCCTGGATGGCAGG + Intronic
1032437133 7:131909512-131909534 CGAGCGAGGCGCCGGCCGGCCGG - Intergenic
1033664093 7:143424572-143424594 CGAGCACAGCGCCGGTGGGCTGG + Intergenic
1034155028 7:148949266-148949288 CGAGCACAGCGCCGGTGGGCCGG - Intergenic
1035999251 8:4583012-4583034 CGAGCACAGCGCCGGTGGGCTGG - Intronic
1041918940 8:63162174-63162196 CGAGCACAGCGCCGGTGGGCTGG - Intergenic
1043073337 8:75665640-75665662 CGAGCACAGCGCCGGTGGGCTGG + Intergenic
1048299129 8:133238778-133238800 CGAGTTAGGCGCAGTATGGCAGG + Exonic
1049214691 8:141402295-141402317 TGAGCAGGGCGCCAGAGGGCTGG - Intronic
1051305078 9:15700217-15700239 CGAGCACAGCGCCGGTGGGCTGG + Intronic
1051892704 9:21959435-21959457 CGAGCACAGCGCCGGTGGGCCGG - Intronic
1052903857 9:33817395-33817417 GGAGGAAGGCGGCGGAGGGCCGG - Intergenic
1060811941 9:126615073-126615095 CGAGCACGGCGCAGGGTGGCCGG - Intronic
1062027243 9:134346261-134346283 CCAGCAAGCCGCGGGAGGGCAGG - Intronic
1062308168 9:135921300-135921322 CGTCCCAGGAGCCGGATGGCTGG - Intergenic
1187557565 X:20367026-20367048 CGAGCACAGCGCCGGTGGGCCGG + Intergenic
1190413956 X:50163507-50163529 CGAGCACAGCGCCGGTGGGCCGG + Intergenic
1193538150 X:82738380-82738402 CGAGCACAGCGCCGGTGGGCTGG + Intergenic
1196714622 X:118799140-118799162 CGAGCACAGCGCCGGTGGGCCGG - Intergenic
1196775210 X:119332058-119332080 CGAGCACAGCGCCGGTCGGCTGG - Intergenic
1199175544 X:144783802-144783824 CGAGCACAGCGCCGGTGGGCTGG - Intergenic
1199831275 X:151551364-151551386 CGAGCACAGCGCCGGTGGGCCGG + Intergenic
1201424254 Y:13831532-13831554 CGAGCATGGCGCAGGTGGGCCGG - Intergenic