ID: 1005475612

View in Genome Browser
Species Human (GRCh38)
Location 6:26204745-26204767
Sequence GCGACGAGCAAGGCGCCGGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 47
Summary {0: 1, 1: 2, 2: 1, 3: 0, 4: 43}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005475612_1005475619 0 Left 1005475612 6:26204745-26204767 CCATCCGGCGCCTTGCTCGTCGC 0: 1
1: 2
2: 1
3: 0
4: 43
Right 1005475619 6:26204768-26204790 GGGGGTGTCAAGCGCATTTCTGG 0: 1
1: 1
2: 2
3: 9
4: 63
1005475612_1005475622 25 Left 1005475612 6:26204745-26204767 CCATCCGGCGCCTTGCTCGTCGC 0: 1
1: 2
2: 1
3: 0
4: 43
Right 1005475622 6:26204793-26204815 TCATCTACGAGGAGACTCGCGGG 0: 3
1: 1
2: 0
3: 3
4: 19
1005475612_1005475621 24 Left 1005475612 6:26204745-26204767 CCATCCGGCGCCTTGCTCGTCGC 0: 1
1: 2
2: 1
3: 0
4: 43
Right 1005475621 6:26204792-26204814 CTCATCTACGAGGAGACTCGCGG 0: 3
1: 2
2: 5
3: 3
4: 36
1005475612_1005475623 26 Left 1005475612 6:26204745-26204767 CCATCCGGCGCCTTGCTCGTCGC 0: 1
1: 2
2: 1
3: 0
4: 43
Right 1005475623 6:26204794-26204816 CATCTACGAGGAGACTCGCGGGG 0: 3
1: 1
2: 0
3: 2
4: 25
1005475612_1005475620 14 Left 1005475612 6:26204745-26204767 CCATCCGGCGCCTTGCTCGTCGC 0: 1
1: 2
2: 1
3: 0
4: 43
Right 1005475620 6:26204782-26204804 CATTTCTGGTCTCATCTACGAGG 0: 2
1: 0
2: 2
3: 17
4: 270

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005475612 Original CRISPR GCGACGAGCAAGGCGCCGGA TGG (reversed) Exonic
900109715 1:1000346-1000368 GGGCCGAGCAACGCGCCGGGAGG + Intergenic
903002472 1:20276079-20276101 GCGAAGAGCAAGGAGCAGCATGG - Intergenic
905257338 1:36693317-36693339 GTGCCGAGCCAGGCGCCGGGTGG - Intergenic
1075842325 10:125515675-125515697 GCCACCAGCAAGGCTCCAGAGGG + Intergenic
1079689373 11:23403429-23403451 GCGGAGAGCAAGGCGGCGGCGGG + Intergenic
1095977552 12:47950062-47950084 ACGCCGAGCAGGGGGCCGGAGGG + Intergenic
1113917763 13:113884397-113884419 GTGACCAGCAGGGCGCCCGATGG + Intergenic
1127480374 15:59372179-59372201 GCGAGGGGCACGGCGCGGGAGGG - Intronic
1141741827 16:85898786-85898808 GCCACTAGCAACGAGCCGGACGG - Exonic
1153688107 18:7566905-7566927 GCTTCGAGCCTGGCGCCGGACGG - Exonic
1153872621 18:9334724-9334746 GCGGGGAGCAAGGAGCCGGGAGG + Intergenic
1155258133 18:24015472-24015494 GCGAGGAGCAGGCAGCCGGAGGG - Intronic
1160983260 19:1826397-1826419 GGGAGGAGAAAGGAGCCGGAGGG + Intronic
1163154535 19:15432646-15432668 GCGGAGAGCAAGGCGGCGGCGGG - Intronic
1167843380 19:52140000-52140022 GCGACCAGCAAGGGGCGGGTCGG + Intergenic
927514334 2:23663110-23663132 GCGAGGAGCAGGGCGCGGTAGGG - Intronic
927652396 2:24920336-24920358 GCGGCGAGGGAGGCGCCGGGCGG + Intergenic
928421029 2:31138066-31138088 CCGACGAGTCAGGCGCCGCATGG + Exonic
935596799 2:104884981-104885003 GGGACGGGCAAGGAGCAGGAGGG + Intergenic
946089434 2:217207761-217207783 GTGAGAAGCAAGGCCCCGGAGGG - Intergenic
947596072 2:231412456-231412478 GCGAGGAGCAAGGGGCTGGCCGG + Intergenic
1176135754 20:63521321-63521343 GCCACGAGCGAGCCGCTGGAGGG - Exonic
1176414725 21:6467818-6467840 GCGAAGAGGAAGGCGGGGGAGGG - Intergenic
1179690225 21:43076140-43076162 GCGAAGAGGAAGGCGGGGGAGGG - Intronic
1181521557 22:23451250-23451272 CAGACGAGCAAGACGCCTGAGGG + Intergenic
1183184954 22:36286403-36286425 GCGACGGGCAGGGCGGCCGAGGG + Intronic
1183674290 22:39291053-39291075 GCCACGAGGAAGGCGCTGGGCGG - Intergenic
1185349559 22:50327341-50327363 CCGACGAGCCCGGCGCCGGCTGG - Intergenic
961042711 3:123688670-123688692 GCCATGAGCAAGGGGCAGGATGG - Intronic
981550378 4:145936960-145936982 GGGACGCGGGAGGCGCCGGAGGG - Intronic
985675153 5:1227109-1227131 TCGACGGGCAAGGCGTCGGCGGG - Intronic
1002718485 5:181243829-181243851 GCGACGAGGATGGCACTGGATGG + Exonic
1005456728 6:26027130-26027152 ACGCCTAGCAAGGCGCCGAATGG + Exonic
1005475612 6:26204745-26204767 GCGACGAGCAAGGCGCCGGATGG - Exonic
1005570356 6:27139409-27139431 GCGGCGAGCAAGGCGCCGAATGG - Exonic
1005643988 6:27824225-27824247 GCGGCGAGCAAGGCGCCGGATGG - Exonic
1005645209 6:27831405-27831427 GCGGCGAGCAAGGCGCCGGATGG + Exonic
1018738138 6:166705221-166705243 GCCAAGAGCAAGGCGCCAGCTGG + Intronic
1019451187 7:1099262-1099284 GAGACCAGCGAGGCTCCGGAAGG - Intronic
1022410482 7:30135499-30135521 GCGGCGGGCAAGGCGCCCGGAGG + Intronic
1034267985 7:149790379-149790401 GCGACGAGCGCGGCTGCGGAGGG + Intergenic
1035129533 7:156639887-156639909 GCGTCGAGTAAAGCACCGGAAGG + Exonic
1035989199 8:4469519-4469541 GAGAAGAGGAAGGCTCCGGAAGG - Intronic
1038828338 8:31032339-31032361 GCAAAGAGCAAGGCTCCAGAAGG - Exonic
1056710771 9:88990875-88990897 GGGACCAGGCAGGCGCCGGAGGG + Intronic
1060536916 9:124397514-124397536 GCTACTAGCCAGGCGCCTGAAGG - Intronic
1198055024 X:132985316-132985338 GCGAGGAGCAAGGGGCAGCATGG - Intergenic