ID: 1005475615

View in Genome Browser
Species Human (GRCh38)
Location 6:26204749-26204771
Sequence CCCCGCGACGAGCAAGGCGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 1, 2: 4, 3: 3, 4: 44}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005475615_1005475620 10 Left 1005475615 6:26204749-26204771 CCGGCGCCTTGCTCGTCGCGGGG 0: 1
1: 1
2: 4
3: 3
4: 44
Right 1005475620 6:26204782-26204804 CATTTCTGGTCTCATCTACGAGG 0: 2
1: 0
2: 2
3: 17
4: 270
1005475615_1005475623 22 Left 1005475615 6:26204749-26204771 CCGGCGCCTTGCTCGTCGCGGGG 0: 1
1: 1
2: 4
3: 3
4: 44
Right 1005475623 6:26204794-26204816 CATCTACGAGGAGACTCGCGGGG 0: 3
1: 1
2: 0
3: 2
4: 25
1005475615_1005475622 21 Left 1005475615 6:26204749-26204771 CCGGCGCCTTGCTCGTCGCGGGG 0: 1
1: 1
2: 4
3: 3
4: 44
Right 1005475622 6:26204793-26204815 TCATCTACGAGGAGACTCGCGGG 0: 3
1: 1
2: 0
3: 3
4: 19
1005475615_1005475621 20 Left 1005475615 6:26204749-26204771 CCGGCGCCTTGCTCGTCGCGGGG 0: 1
1: 1
2: 4
3: 3
4: 44
Right 1005475621 6:26204792-26204814 CTCATCTACGAGGAGACTCGCGG 0: 3
1: 2
2: 5
3: 3
4: 36
1005475615_1005475619 -4 Left 1005475615 6:26204749-26204771 CCGGCGCCTTGCTCGTCGCGGGG 0: 1
1: 1
2: 4
3: 3
4: 44
Right 1005475619 6:26204768-26204790 GGGGGTGTCAAGCGCATTTCTGG 0: 1
1: 1
2: 2
3: 9
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005475615 Original CRISPR CCCCGCGACGAGCAAGGCGC CGG (reversed) Exonic
905862548 1:41361203-41361225 CTCCGCGCCGAGCAGGGGGCGGG + Intergenic
917906762 1:179592443-179592465 CCCGGCCACGCGCAAGCCGCAGG + Intronic
917962378 1:180155135-180155157 CGCCCCGACGTGGAAGGCGCTGG + Exonic
920379821 1:205528978-205529000 CCCTGCGAGGAGCAAGGGGTAGG - Exonic
1064028794 10:11869976-11869998 CCCCGCGGCGGGGAAGGCGCCGG - Exonic
1068955218 10:62815137-62815159 CCCGGCCTCGAGGAAGGCGCGGG + Intronic
1076096482 10:127737763-127737785 CCCCGCGACGAGGACGACCCAGG + Exonic
1104203549 12:126615098-126615120 CCCCGCGATGAGCAAGGCGTGGG + Intergenic
1125689604 15:41585483-41585505 CCCCGCGGCCTGCAGGGCGCCGG - Intergenic
1129360912 15:75023605-75023627 CCCCGAGACGCGCCTGGCGCGGG + Exonic
1132879467 16:2155645-2155667 CCCCGCGACGACGAGGCCGCCGG + Intergenic
1132915727 16:2342084-2342106 CCCCGCGCCCAGCCAGCCGCCGG + Intergenic
1138327955 16:56191299-56191321 CCCCGGGACGGGGAGGGCGCGGG - Intergenic
1141110914 16:81270054-81270076 CCCCGCCAGGAGCTAGGCTCAGG - Intronic
1142396865 16:89837075-89837097 CCACGCGACGGGCCAGGCACGGG - Intronic
1144672988 17:17143442-17143464 CCTCGCCAGGAGCAAGGCCCTGG + Intronic
1162506569 19:11089580-11089602 CGCGGCGAGGAGCAAGGCGACGG - Exonic
1165420047 19:35718049-35718071 CCCCGCGCGGAGCCAGGCCCGGG - Exonic
1166571294 19:43798678-43798700 CCCCGAGACGTGCTAGGCGCGGG - Intronic
1167843378 19:52139996-52140018 AGCCGCGACCAGCAAGGGGCGGG + Intergenic
934078964 2:88451895-88451917 CCCCGCGACGAGGACGACCCAGG - Exonic
947596069 2:231412452-231412474 CCCCGCGAGGAGCAAGGGGCTGG + Intergenic
1172359650 20:34303176-34303198 CCCCGCCACGAACAAGCCCCGGG + Intronic
1176573879 21:8433847-8433869 CCCCGCGACGCAGAAGGCGGCGG - Intergenic
1185343704 22:50302411-50302433 CTCCGCGTGGAGCAAGGGGCTGG - Intronic
1203259979 22_KI270733v1_random:167981-168003 CCCCGCGACGCAGAAGGCGGCGG - Intergenic
954089982 3:48276612-48276634 CCCCGCCATAAGCAAGGCACGGG - Intronic
961539750 3:127591254-127591276 CGCCGCGTGGAGCAGGGCGCTGG - Intronic
962283335 3:134067934-134067956 CCCCGGGGCGAGGAAGGCACAGG + Intronic
968285142 3:197504175-197504197 CCCCGCGTTGTGCCAGGCGCTGG + Intergenic
969566974 4:7984478-7984500 CCACACGGGGAGCAAGGCGCAGG + Intronic
975985942 4:80202027-80202049 CCCCAAGACGAACAAGGCGGCGG + Exonic
981076594 4:140598534-140598556 CTCCGCCATGAGCAAGGCGCAGG + Intergenic
991371683 5:65925977-65925999 CCCCGAGACGCGCAGGGGGCGGG - Intergenic
1001246087 5:170106510-170106532 CCCCGCGACGAGGACGACCCGGG + Exonic
1002637385 5:180615077-180615099 CACCGCACGGAGCAAGGCGCGGG + Intronic
1005473927 6:26188950-26188972 CGCCGCGGCGAGCCAGGCGGCGG + Exonic
1005475615 6:26204749-26204771 CCCCGCGACGAGCAAGGCGCCGG - Exonic
1005484327 6:26285373-26285395 CGCCGCGACGAGCAAGGCGCCGG + Exonic
1005643990 6:27824229-27824251 CGCCGCGGCGAGCAAGGCGCCGG - Exonic
1005645207 6:27831401-27831423 CGCCGCGGCGAGCAAGGCGCCGG + Exonic
1014913892 6:127121257-127121279 CCCAGCGAGGACCACGGCGCAGG + Intronic
1020018435 7:4846007-4846029 CACCGCGTCCAGCATGGCGCTGG + Intronic
1021737893 7:23657133-23657155 CCCTGCCACGAGCAGGGCGTAGG - Intergenic
1026045673 7:66904076-66904098 CGCAGCCACGAGCAAGGAGCTGG - Intergenic
1029495756 7:100894997-100895019 CCCCGCCCCGAGCCAGGAGCCGG + Intronic
1057358022 9:94347659-94347681 AGCCGCGGCGAGCAAGGAGCTGG + Intergenic
1057649727 9:96909958-96909980 AGCCGCGGCGAGCAAGGAGCTGG - Intronic
1061832629 9:133305101-133305123 CCCGGGGAAGTGCAAGGCGCAGG + Intergenic
1062349519 9:136132259-136132281 CCCCGGGAGGACCCAGGCGCAGG + Intergenic
1062637585 9:137499700-137499722 CCCCGAGCCGGGCAAGGGGCAGG - Intronic
1203468330 Un_GL000220v1:106049-106071 CCCCGCGACGCAGAAGGCGGCGG - Intergenic
1203476151 Un_GL000220v1:150021-150043 CCCCGCGACGCAGAAGGCGGCGG - Intergenic