ID: 1005475616

View in Genome Browser
Species Human (GRCh38)
Location 6:26204749-26204771
Sequence CCGGCGCCTTGCTCGTCGCG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 27
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 23}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005475608_1005475616 1 Left 1005475608 6:26204725-26204747 CCAGGGCATTACCAAGCCTGCCA 0: 1
1: 0
2: 4
3: 7
4: 165
Right 1005475616 6:26204749-26204771 CCGGCGCCTTGCTCGTCGCGGGG 0: 1
1: 0
2: 0
3: 3
4: 23
1005475604_1005475616 25 Left 1005475604 6:26204701-26204723 CCGTAAGGTCCTGCGAGATAACA 0: 1
1: 0
2: 1
3: 3
4: 47
Right 1005475616 6:26204749-26204771 CCGGCGCCTTGCTCGTCGCGGGG 0: 1
1: 0
2: 0
3: 3
4: 23
1005475607_1005475616 16 Left 1005475607 6:26204710-26204732 CCTGCGAGATAACATCCAGGGCA 0: 1
1: 0
2: 0
3: 4
4: 53
Right 1005475616 6:26204749-26204771 CCGGCGCCTTGCTCGTCGCGGGG 0: 1
1: 0
2: 0
3: 3
4: 23
1005475610_1005475616 -10 Left 1005475610 6:26204736-26204758 CCAAGCCTGCCATCCGGCGCCTT 0: 1
1: 2
2: 1
3: 9
4: 115
Right 1005475616 6:26204749-26204771 CCGGCGCCTTGCTCGTCGCGGGG 0: 1
1: 0
2: 0
3: 3
4: 23

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005475616 Original CRISPR CCGGCGCCTTGCTCGTCGCG GGG Exonic