ID: 1005475617

View in Genome Browser
Species Human (GRCh38)
Location 6:26204750-26204772
Sequence CGGCGCCTTGCTCGTCGCGG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 2, 1: 3, 2: 0, 3: 7, 4: 52}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005475608_1005475617 2 Left 1005475608 6:26204725-26204747 CCAGGGCATTACCAAGCCTGCCA 0: 1
1: 0
2: 4
3: 7
4: 165
Right 1005475617 6:26204750-26204772 CGGCGCCTTGCTCGTCGCGGGGG 0: 2
1: 3
2: 0
3: 7
4: 52
1005475604_1005475617 26 Left 1005475604 6:26204701-26204723 CCGTAAGGTCCTGCGAGATAACA 0: 1
1: 0
2: 1
3: 3
4: 47
Right 1005475617 6:26204750-26204772 CGGCGCCTTGCTCGTCGCGGGGG 0: 2
1: 3
2: 0
3: 7
4: 52
1005475610_1005475617 -9 Left 1005475610 6:26204736-26204758 CCAAGCCTGCCATCCGGCGCCTT 0: 1
1: 2
2: 1
3: 9
4: 115
Right 1005475617 6:26204750-26204772 CGGCGCCTTGCTCGTCGCGGGGG 0: 2
1: 3
2: 0
3: 7
4: 52
1005475607_1005475617 17 Left 1005475607 6:26204710-26204732 CCTGCGAGATAACATCCAGGGCA 0: 1
1: 0
2: 0
3: 4
4: 53
Right 1005475617 6:26204750-26204772 CGGCGCCTTGCTCGTCGCGGGGG 0: 2
1: 3
2: 0
3: 7
4: 52

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005475617 Original CRISPR CGGCGCCTTGCTCGTCGCGG GGG Exonic