ID: 1005475618

View in Genome Browser
Species Human (GRCh38)
Location 6:26204755-26204777
Sequence TGACACCCCCGCGACGAGCA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 29
Summary {0: 1, 1: 1, 2: 1, 3: 0, 4: 26}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005475618_1005475619 -10 Left 1005475618 6:26204755-26204777 CCTTGCTCGTCGCGGGGGTGTCA 0: 1
1: 1
2: 1
3: 0
4: 26
Right 1005475619 6:26204768-26204790 GGGGGTGTCAAGCGCATTTCTGG 0: 1
1: 1
2: 2
3: 9
4: 63
1005475618_1005475622 15 Left 1005475618 6:26204755-26204777 CCTTGCTCGTCGCGGGGGTGTCA 0: 1
1: 1
2: 1
3: 0
4: 26
Right 1005475622 6:26204793-26204815 TCATCTACGAGGAGACTCGCGGG 0: 3
1: 1
2: 0
3: 3
4: 19
1005475618_1005475620 4 Left 1005475618 6:26204755-26204777 CCTTGCTCGTCGCGGGGGTGTCA 0: 1
1: 1
2: 1
3: 0
4: 26
Right 1005475620 6:26204782-26204804 CATTTCTGGTCTCATCTACGAGG 0: 2
1: 0
2: 2
3: 17
4: 270
1005475618_1005475623 16 Left 1005475618 6:26204755-26204777 CCTTGCTCGTCGCGGGGGTGTCA 0: 1
1: 1
2: 1
3: 0
4: 26
Right 1005475623 6:26204794-26204816 CATCTACGAGGAGACTCGCGGGG 0: 3
1: 1
2: 0
3: 2
4: 25
1005475618_1005475621 14 Left 1005475618 6:26204755-26204777 CCTTGCTCGTCGCGGGGGTGTCA 0: 1
1: 1
2: 1
3: 0
4: 26
Right 1005475621 6:26204792-26204814 CTCATCTACGAGGAGACTCGCGG 0: 3
1: 2
2: 5
3: 3
4: 36
1005475618_1005475624 25 Left 1005475618 6:26204755-26204777 CCTTGCTCGTCGCGGGGGTGTCA 0: 1
1: 1
2: 1
3: 0
4: 26
Right 1005475624 6:26204803-26204825 GGAGACTCGCGGGGTTCTGAAGG 0: 1
1: 2
2: 2
3: 10
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005475618 Original CRISPR TGACACCCCCGCGACGAGCA AGG (reversed) Exonic
902563838 1:17296725-17296747 TGACACCCCCGCAAGGAAGAGGG + Intergenic
912450993 1:109767705-109767727 TGACACCCCCAAGCCGAGTAAGG - Intronic
1084086943 11:66859193-66859215 TGACACCCCCTCCCCGACCATGG + Intronic
1085980494 11:81718417-81718439 TGACACCCCCTGGACCAGAAAGG + Intergenic
1104203545 12:126615092-126615114 TGATACCCCCGCGATGAGCAAGG + Intergenic
1125529163 15:40400517-40400539 TGTCACCCAGGTGACGAGCATGG + Intergenic
1152584406 17:81182532-81182554 TGACCCCCCCGCCACAAGCCAGG - Intergenic
1156484200 18:37454567-37454589 TCACACCCCCGCAATAAGCAAGG + Intronic
1157252159 18:46104490-46104512 TGACACCCCCGCGCCGACAGCGG + Intronic
1166641686 19:44499577-44499599 AGACACCCCCAGGACGTGCAGGG + Intronic
936774395 2:115955339-115955361 TGGCACCACCCCCACGAGCATGG - Intergenic
937208545 2:120252739-120252761 TGACAGCCCCCCGACGGGCGTGG + Exonic
946422007 2:219570586-219570608 TGCCACGCCCGCAACGCGCACGG - Exonic
1184302847 22:43572668-43572690 TGACATCCGAGCGACGAGGAGGG - Intronic
1185246855 22:49777269-49777291 TGACACCCCCGCGGCCAGACGGG + Intronic
964438287 3:156675668-156675690 CGACACCCCGGCGCCGAGCCCGG - Intronic
981449860 4:144884381-144884403 TGACACCCCAGCTCCCAGCATGG - Intergenic
1005473924 6:26188944-26188966 TGACGCCGCCGCGGCGAGCCAGG + Exonic
1005475618 6:26204755-26204777 TGACACCCCCGCGACGAGCAAGG - Exonic
1005484325 6:26285367-26285389 TGACACCGCCGCGACGAGCAAGG + Exonic
1005570359 6:27139419-27139441 TCACGCCGCCGCGGCGAGCAAGG - Exonic
1005643992 6:27824235-27824257 TCACGCCGCCGCGGCGAGCAAGG - Exonic
1005645205 6:27831395-27831417 TCACGCCGCCGCGGCGAGCAAGG + Exonic
1006228330 6:32559815-32559837 TGAAACACCCCCGAAGAGCAAGG - Intronic
1018642662 6:165918784-165918806 TGACACCCCCGAGAGGAAGAGGG - Intronic
1021737896 7:23657139-23657161 TCATACCCCTGCCACGAGCAGGG - Intergenic
1058847127 9:108972087-108972109 TGACCCTCCCGGGAGGAGCATGG - Intronic
1061957223 9:133969999-133970021 TGCCACCCCCCAGACGTGCAGGG + Intronic
1191072092 X:56411292-56411314 TGACTCCCCCGGGAAGTGCAAGG - Intergenic