ID: 1005475619

View in Genome Browser
Species Human (GRCh38)
Location 6:26204768-26204790
Sequence GGGGGTGTCAAGCGCATTTC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 1, 2: 2, 3: 9, 4: 63}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005475618_1005475619 -10 Left 1005475618 6:26204755-26204777 CCTTGCTCGTCGCGGGGGTGTCA 0: 1
1: 1
2: 1
3: 0
4: 26
Right 1005475619 6:26204768-26204790 GGGGGTGTCAAGCGCATTTCTGG 0: 1
1: 1
2: 2
3: 9
4: 63
1005475612_1005475619 0 Left 1005475612 6:26204745-26204767 CCATCCGGCGCCTTGCTCGTCGC 0: 1
1: 2
2: 1
3: 0
4: 43
Right 1005475619 6:26204768-26204790 GGGGGTGTCAAGCGCATTTCTGG 0: 1
1: 1
2: 2
3: 9
4: 63
1005475615_1005475619 -4 Left 1005475615 6:26204749-26204771 CCGGCGCCTTGCTCGTCGCGGGG 0: 1
1: 1
2: 4
3: 3
4: 44
Right 1005475619 6:26204768-26204790 GGGGGTGTCAAGCGCATTTCTGG 0: 1
1: 1
2: 2
3: 9
4: 63
1005475608_1005475619 20 Left 1005475608 6:26204725-26204747 CCAGGGCATTACCAAGCCTGCCA 0: 1
1: 0
2: 4
3: 7
4: 165
Right 1005475619 6:26204768-26204790 GGGGGTGTCAAGCGCATTTCTGG 0: 1
1: 1
2: 2
3: 9
4: 63
1005475610_1005475619 9 Left 1005475610 6:26204736-26204758 CCAAGCCTGCCATCCGGCGCCTT 0: 1
1: 2
2: 1
3: 9
4: 115
Right 1005475619 6:26204768-26204790 GGGGGTGTCAAGCGCATTTCTGG 0: 1
1: 1
2: 2
3: 9
4: 63
1005475611_1005475619 4 Left 1005475611 6:26204741-26204763 CCTGCCATCCGGCGCCTTGCTCG 0: 3
1: 2
2: 1
3: 12
4: 131
Right 1005475619 6:26204768-26204790 GGGGGTGTCAAGCGCATTTCTGG 0: 1
1: 1
2: 2
3: 9
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005475619 Original CRISPR GGGGGTGTCAAGCGCATTTC TGG Exonic
910990800 1:93053801-93053823 GGGGCTGTCCTGCGCATTGCAGG - Intergenic
920831411 1:209469170-209469192 GGGGGTGTCAATGGCATGCCTGG + Intergenic
1062846190 10:707687-707709 TGGGGTGTGAAGGGCAATTCTGG - Intergenic
1072267990 10:93748836-93748858 GGGGGTGCTAAGAGCATTTGGGG + Intergenic
1072896672 10:99373238-99373260 GGGTGTGTGAAGCCCATGTCTGG + Intronic
1073453963 10:103625507-103625529 GGTGGGGGCAAGGGCATTTCAGG + Intronic
1088549086 11:110992151-110992173 GGGGGTGGGAAGTGCATTCCAGG - Intergenic
1091583682 12:1803962-1803984 GGGAGGGTCAAGGGCATTCCAGG + Intronic
1091786315 12:3245260-3245282 GAAGGTGCCAAGCCCATTTCTGG + Intronic
1093077269 12:14770939-14770961 GGGGGCGTCAAGCGCATTTCTGG - Exonic
1104971453 12:132532697-132532719 CGGGGTGTTAAGCGCAGTGCAGG + Intronic
1112332696 13:98488897-98488919 GAGGCTGCCAAGGGCATTTCAGG - Intronic
1116992138 14:51287671-51287693 GGGGGTGTCAAAAGCAGGTCAGG + Intergenic
1120023876 14:79560421-79560443 GGGGGTGGGAGGAGCATTTCTGG + Intronic
1122066402 14:99176683-99176705 GGGGCTGTCCTGCGCATTGCAGG + Intronic
1130907033 15:88247982-88248004 TGGGGTGCCAGGAGCATTTCTGG - Intronic
1132380205 15:101360845-101360867 CAGGGTGACAAGGGCATTTCAGG - Intronic
1132987244 16:2773899-2773921 GGGAGTGCCAAGAGCATATCTGG - Intronic
1133140892 16:3743222-3743244 GGGGCTGTCCTGCGCATTACAGG - Intronic
1133790946 16:9008798-9008820 GGGGGTGTCCACCGCAGTCCTGG + Intergenic
1134433392 16:14233340-14233362 GAGGGTGTAAAGCACATTTATGG + Intronic
1142032102 16:87843753-87843775 GGGGGTGTCCCGTGCATTGCAGG - Intronic
1142941420 17:3382705-3382727 GGGAGTGGAAAGGGCATTTCAGG - Intergenic
1146231540 17:31115244-31115266 GGGGCTGTCCTGTGCATTTCAGG - Intronic
1146612462 17:34319801-34319823 GTGGGTGTAAAGGACATTTCAGG + Intronic
1146775748 17:35614133-35614155 GGGGCTGTCAAGAGCATCTCTGG - Intronic
1150210262 17:63437887-63437909 GGGGGGGACATGCGCATCTCAGG - Intronic
1156516695 18:37686173-37686195 GGGGGTGCCAAGGGCACTTCTGG + Intergenic
1158186301 18:54775749-54775771 GGGAGTTTCATGAGCATTTCAGG - Intronic
1159287136 18:66368866-66368888 GTGGGTGTCAAGATCATTTAAGG + Intergenic
1161551592 19:4915914-4915936 GGGGTTCTCAAACGGATTTCAGG + Intronic
1163021429 19:14482828-14482850 GGGGGGGGCAAGCCCATTTGGGG + Exonic
1165006970 19:32815191-32815213 GGGGGTGGCAAGAGCAAATCTGG - Intronic
1165480486 19:36060652-36060674 GGGGGTGAAAAGCACATTCCTGG - Intronic
926331900 2:11832510-11832532 GTGGATGTCAAGGGCATCTCCGG - Intergenic
936234910 2:110733859-110733881 GGGGGACCCAAGAGCATTTCAGG + Intronic
936351558 2:111716608-111716630 GGGGGAGTCAAGAGCATAGCTGG - Intergenic
937348579 2:121143929-121143951 GGGGCTGTCCTGCGCATTGCAGG + Intergenic
945878682 2:215304769-215304791 GGGTGTGTCGTGAGCATTTCAGG - Intergenic
1169763658 20:9125066-9125088 GATGGAGTCAAGCGTATTTCAGG - Intronic
1170181977 20:13541685-13541707 AGAGGTGTCAAGGGCTTTTCTGG - Intronic
1174177893 20:48656582-48656604 GGGGGAGTCAAGGGGATTTCTGG - Intronic
1174204734 20:48829984-48830006 GGGCGTGTCCTGTGCATTTCAGG + Intergenic
1174444437 20:50581058-50581080 GGGGGTGACAAGTGGACTTCAGG + Intronic
1184236147 22:43184106-43184128 GGGGGTGTCATCCACCTTTCAGG + Intronic
1185247212 22:49779560-49779582 GGGGGTGTCATACTCATTTCTGG + Intronic
968664493 4:1813652-1813674 GGGGCTCTGAAGCGCATTTGGGG - Exonic
983452893 4:167929277-167929299 GAGGGTGTCAAGGGCGATTCTGG + Intergenic
987119762 5:14756025-14756047 GGGGGTATAAAGTGTATTTCAGG - Intronic
989707758 5:44358027-44358049 GAGGGGGGCAAGGGCATTTCTGG + Intronic
990458972 5:56014874-56014896 GGGGGTGTCAGCCCCATGTCCGG - Intergenic
995794635 5:115928692-115928714 GGGGGTGTCCTGTGCATTGCAGG + Intergenic
1005456189 6:26021802-26021824 GGCGGTGTGAAGCGGATCTCTGG + Exonic
1005456722 6:26027107-26027129 GGTGGGGTTAAGCGAATTTCCGG - Exonic
1005464977 6:26104071-26104093 GGTGGCGTCAAGCGCATTTCCGG + Exonic
1005473922 6:26188931-26188953 GGCGGCGTCAAGCGTATTTCTGG - Exonic
1005475619 6:26204768-26204790 GGGGGTGTCAAGCGCATTTCTGG + Exonic
1005479324 6:26240549-26240571 GGCGGCGTGAAACGCATTTCGGG + Exonic
1005480012 6:26246832-26246854 GGCGGTGTCAAGCGCATCTTGGG - Exonic
1005484324 6:26285354-26285376 GGCGGTGTCAAGCGAATTTCTGG - Exonic
1005570361 6:27139432-27139454 GGCGGCGTGAAGCGCATTTCTGG + Exonic
1005643994 6:27824248-27824270 GGCGGCGTGAAGCGCATCTCCGG + Exonic
1005645203 6:27831382-27831404 GGCGGCGTGAAGCGCATCTCCGG - Exonic
1005649457 6:27873365-27873387 GGAGGCGTTAAGCGCATCTCAGG - Exonic
1020212468 7:6166819-6166841 GGCGGTGGCAACCGCATTGCAGG - Intronic
1020434399 7:8147159-8147181 GGAGCTGTCAAGGGCATGTCAGG - Intronic
1021551202 7:21872856-21872878 GAGGGTGTCAGGCACATTTCTGG + Intronic
1032314572 7:130823360-130823382 GATGGTGTCAAGAGCATTTCTGG - Intergenic
1037360461 8:18068672-18068694 GGGGCTGTCATGTGCATTGCAGG - Intronic
1037360475 8:18068745-18068767 GGGGCTGTCATGTGCATTGCAGG - Intronic
1038431617 8:27504888-27504910 GGGGGTATCTGGAGCATTTCAGG + Intronic
1046530153 8:115435247-115435269 CTGGATGTCAATCGCATTTCTGG + Intronic
1057800491 9:98188176-98188198 GGGTGAGTCAGGCTCATTTCTGG - Intronic
1060187930 9:121575193-121575215 GGGGGTGTTAAGTACAGTTCAGG - Intronic
1061948550 9:133922293-133922315 GTGGGTGTCAAGCCCCTTCCTGG - Intronic
1196399686 X:115300753-115300775 GGTGGTGCCAAGAGCATCTCTGG - Intronic