ID: 1005475623

View in Genome Browser
Species Human (GRCh38)
Location 6:26204794-26204816
Sequence CATCTACGAGGAGACTCGCG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 31
Summary {0: 3, 1: 1, 2: 0, 3: 2, 4: 25}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005475611_1005475623 30 Left 1005475611 6:26204741-26204763 CCTGCCATCCGGCGCCTTGCTCG 0: 3
1: 2
2: 1
3: 12
4: 131
Right 1005475623 6:26204794-26204816 CATCTACGAGGAGACTCGCGGGG 0: 3
1: 1
2: 0
3: 2
4: 25
1005475612_1005475623 26 Left 1005475612 6:26204745-26204767 CCATCCGGCGCCTTGCTCGTCGC 0: 1
1: 2
2: 1
3: 0
4: 43
Right 1005475623 6:26204794-26204816 CATCTACGAGGAGACTCGCGGGG 0: 3
1: 1
2: 0
3: 2
4: 25
1005475618_1005475623 16 Left 1005475618 6:26204755-26204777 CCTTGCTCGTCGCGGGGGTGTCA 0: 1
1: 1
2: 1
3: 0
4: 26
Right 1005475623 6:26204794-26204816 CATCTACGAGGAGACTCGCGGGG 0: 3
1: 1
2: 0
3: 2
4: 25
1005475615_1005475623 22 Left 1005475615 6:26204749-26204771 CCGGCGCCTTGCTCGTCGCGGGG 0: 1
1: 1
2: 4
3: 3
4: 44
Right 1005475623 6:26204794-26204816 CATCTACGAGGAGACTCGCGGGG 0: 3
1: 1
2: 0
3: 2
4: 25

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005475623 Original CRISPR CATCTACGAGGAGACTCGCG GGG Exonic
903822057 1:26110977-26110999 CCTCCACCAGGAGCCTCGCGGGG + Intergenic
907801700 1:57772536-57772558 CATCTAGGAGTAGACTCGCTGGG + Intronic
909992978 1:82246275-82246297 CATCTAAGAGGAGGCTCAAGAGG + Intergenic
1100855667 12:98755259-98755281 CATGTACGAGGAGACTCTACCGG + Intronic
1112028367 13:95433925-95433947 TATCACCGAGGAGGCTCGCGTGG - Intronic
1113797525 13:113066991-113067013 CATCTACGAGGAGCCCCTCAAGG - Intronic
1115952081 14:38732750-38732772 CATCCACCAGGAGACTCTAGAGG + Intergenic
1134071384 16:11262042-11262064 CTTCTAGGAGGAGACTCGTCTGG + Intronic
1138992530 16:62409139-62409161 CATCTGCTCGGAGAGTCGCGAGG + Intergenic
1139573191 16:67825934-67825956 CAGCTACGAGGAGGTTCGCAAGG + Exonic
1143130381 17:4673618-4673640 CATCAAGGAGGAGACTCACAGGG - Exonic
1145001709 17:19309891-19309913 CAGCTCGGAGGACACTCGCGGGG - Exonic
1149367359 17:55959204-55959226 CATCTCCAAGGAGACTAGCATGG + Intergenic
1150165119 17:62933828-62933850 CAGCAAGGAGGAGACTCGAGAGG + Intergenic
1164069240 19:21750937-21750959 CATCTACGAGGCGGCACCCGGGG + Intronic
1185396120 22:50589823-50589845 CATCTAGGAGGACACTGGAGAGG + Intronic
953373155 3:42406933-42406955 CATCTACGAGAACACACGTGAGG - Exonic
954993182 3:54858624-54858646 CCTCTAAGAGGAGACTCGACTGG + Intronic
964569326 3:158094936-158094958 CATCAACCAGGAGACCCGCAAGG + Intergenic
986897928 5:12393510-12393532 CTTCCACAAGGAGACTTGCGAGG + Intergenic
998140860 5:139698674-139698696 CATCTGGGAGGAGACTCGGGAGG + Intergenic
1005456193 6:26021828-26021850 GATCTACGAGGAGACTCGCGGGG + Exonic
1005475623 6:26204794-26204816 CATCTACGAGGAGACTCGCGGGG + Exonic
1005480008 6:26246806-26246828 CATTTATGAGGAGACCCGCCGGG - Exonic
1005644000 6:27824274-27824296 CATCTACGAGGAGACTCGCGGGG + Exonic
1005645197 6:27831356-27831378 CATCTACGAGGAGACTCGCGGGG - Exonic
1006920211 6:37623000-37623022 CACCAATGAGGAGACTCGGGAGG - Intergenic
1016334219 6:142986994-142987016 CATCTACAAGGAGAATCAAGTGG + Intergenic
1049682433 8:143925560-143925582 CATCGAGGAGGAGATCCGCGTGG - Exonic
1062368105 9:136221557-136221579 CACCTAGGAGGAGCCTGGCGTGG - Intronic
1195574124 X:106430939-106430961 CATCTGCAAGGAGACTTGCAAGG + Intergenic