ID: 1005478785

View in Genome Browser
Species Human (GRCh38)
Location 6:26234851-26234873
Sequence AAGAAAAAGGCGAAGAAGGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1251
Summary {0: 1, 1: 0, 2: 2, 3: 103, 4: 1145}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005478785_1005478789 -3 Left 1005478785 6:26234851-26234873 CCTGCCTTCTTCGCCTTTTTCTT 0: 1
1: 0
2: 2
3: 103
4: 1145
Right 1005478789 6:26234871-26234893 CTTCACAGGTGTTTTTTCTGCGG 0: 1
1: 0
2: 2
3: 29
4: 292
1005478785_1005478791 4 Left 1005478785 6:26234851-26234873 CCTGCCTTCTTCGCCTTTTTCTT 0: 1
1: 0
2: 2
3: 103
4: 1145
Right 1005478791 6:26234878-26234900 GGTGTTTTTTCTGCGGGTGCAGG 0: 1
1: 0
2: 0
3: 10
4: 130
1005478785_1005478790 -2 Left 1005478785 6:26234851-26234873 CCTGCCTTCTTCGCCTTTTTCTT 0: 1
1: 0
2: 2
3: 103
4: 1145
Right 1005478790 6:26234872-26234894 TTCACAGGTGTTTTTTCTGCGGG 0: 1
1: 0
2: 1
3: 25
4: 267
1005478785_1005478794 22 Left 1005478785 6:26234851-26234873 CCTGCCTTCTTCGCCTTTTTCTT 0: 1
1: 0
2: 2
3: 103
4: 1145
Right 1005478794 6:26234896-26234918 GCAGGAATGGTAGGAGCAAGTGG 0: 1
1: 0
2: 1
3: 27
4: 343
1005478785_1005478792 9 Left 1005478785 6:26234851-26234873 CCTGCCTTCTTCGCCTTTTTCTT 0: 1
1: 0
2: 2
3: 103
4: 1145
Right 1005478792 6:26234883-26234905 TTTTTCTGCGGGTGCAGGAATGG 0: 1
1: 0
2: 1
3: 12
4: 204
1005478785_1005478793 13 Left 1005478785 6:26234851-26234873 CCTGCCTTCTTCGCCTTTTTCTT 0: 1
1: 0
2: 2
3: 103
4: 1145
Right 1005478793 6:26234887-26234909 TCTGCGGGTGCAGGAATGGTAGG 0: 1
1: 0
2: 0
3: 13
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005478785 Original CRISPR AAGAAAAAGGCGAAGAAGGC AGG (reversed) Exonic
900970773 1:5991663-5991685 AGGAAAGGGGCGCAGAAGGCCGG + Intronic
901144334 1:7054940-7054962 AAGATGAAGGGGAAGTAGGCTGG + Intronic
901276896 1:7998852-7998874 AAGAAAAAGTAGAAGAGGCCAGG + Intergenic
901520342 1:9779040-9779062 AAGAAGAAGAAGAAGAAGGCTGG + Intronic
902088744 1:13884935-13884957 AAGAAAAAGAAGAAGAAGGAAGG - Intergenic
902546194 1:17191979-17192001 AAGAAAAAGGAGAAGGAAGAGGG - Intergenic
902726702 1:18340959-18340981 AAGAAGAAGGAGAAGAAGGAGGG - Intronic
903053179 1:20616674-20616696 ATGAAAAAGCTGAAGGAGGCAGG + Intronic
903196850 1:21696447-21696469 AAGAAGAAGGGAAAGAAAGCGGG + Intronic
903264887 1:22152068-22152090 AAAAAAAAGAGGAAGAAGGAAGG - Intergenic
903279649 1:22243428-22243450 AAAAAAAAGAAGAAGAAGGAAGG + Intergenic
903748140 1:25602386-25602408 AAGACAAAGGGGATGCAGGCAGG - Intergenic
904273474 1:29365359-29365381 AAGAAAAAGAAAAAGAAGGAAGG - Intergenic
904389402 1:30171916-30171938 AAGGGAAAGGGGAAGAAGGCTGG + Intergenic
904560682 1:31395206-31395228 AAGAAGAAGAAGAAGAAGGCGGG - Intergenic
904648953 1:31989807-31989829 ATGAAAAAGGTGAAGGATGCCGG - Intergenic
904849779 1:33448592-33448614 AAAAAGAAGTAGAAGAAGGCAGG + Intergenic
904953170 1:34260791-34260813 AAGAAAAAGGAGAAGGAGAAAGG + Intergenic
905077588 1:35287071-35287093 AGGAAAAAGTCGAGGAAGGAAGG - Intronic
905119515 1:35671031-35671053 AAGATAAAGGCGGAGATGGGGGG + Intergenic
905120793 1:35680242-35680264 AAGAAAAAGGTGAAGTTGGCCGG - Intergenic
905191198 1:36236452-36236474 AAGGAAAGGGGGAAGAAGGAAGG - Intronic
905331477 1:37203353-37203375 AAGAAAAAAGGAAAGAAGGAAGG + Intergenic
905506859 1:38486627-38486649 TAGAAAGAAGGGAAGAAGGCAGG + Intergenic
905570491 1:39000643-39000665 AAGAAAAAAGAAAAAAAGGCCGG - Intronic
905575814 1:39043797-39043819 AAGAAAAAGAGGAAGAAGAAAGG + Intergenic
905806158 1:40879102-40879124 AAGAAAAAAGAAAAGAAGGAGGG + Intergenic
905908675 1:41638973-41638995 AAGAAAGTGGAGAAGAAGGCTGG + Intronic
906176283 1:43775986-43776008 AAGAAAAAGGAATAGAAGGCAGG - Intronic
906324838 1:44839023-44839045 AAGAAAAAGTGTAAGAAGGCAGG - Intronic
906456685 1:46003278-46003300 AAGAAAAAGGTGAAAAAGAGGGG - Intronic
906788075 1:48633750-48633772 AAGAAACAGGAGAAGACAGCAGG - Intronic
906802351 1:48749066-48749088 AAGAAAGAGGTGAAAAAAGCAGG + Intronic
907067825 1:51503337-51503359 AAGAAAAAAGCAAAGTAGGCTGG + Intronic
907295845 1:53453552-53453574 AAAAAAAAGAAGAAGAAGGAAGG + Intergenic
907483331 1:54759707-54759729 AACAAAAAAGAAAAGAAGGCTGG + Intronic
907513225 1:54977877-54977899 AAAAAAAAGAAGAAGAAGGCAGG + Intergenic
907514883 1:54987412-54987434 AAAAAAAAGTCTAAGAAGGATGG - Intronic
907516564 1:54996880-54996902 AGAAAAGGGGCGAAGAAGGCTGG + Intergenic
908035443 1:60046429-60046451 AAAAAAAAGAAGAAGAAGGAAGG - Intronic
908185480 1:61648859-61648881 AAGTAAAGGGCGAAGAAAACAGG + Intergenic
908403159 1:63789660-63789682 AAAAAAAAGGAGAGGAAGGATGG - Intronic
909152162 1:72020906-72020928 AAGAAAAAAGTCAAGAAAGCAGG + Intronic
909192968 1:72577546-72577568 AAAAAAAAGAAGAAGAAGGGAGG - Intergenic
909253680 1:73390702-73390724 GAAAAAAAGGCGAAGAAGAAGGG - Intergenic
909521488 1:76573650-76573672 AAAAAAAAGGAGAAGAAAGGGGG - Intronic
909942831 1:81631195-81631217 AAGAAAAAAGAAAAGAAGGTCGG - Intronic
910475223 1:87598699-87598721 AAGAAAATGGAAAGGAAGGCTGG + Intergenic
910480544 1:87653938-87653960 AATAAAAAGAAAAAGAAGGCTGG + Intergenic
910524723 1:88164767-88164789 AAGGCAAAGGGGAAGCAGGCGGG - Intergenic
910593552 1:88953885-88953907 AAGAAGAAGAAGAAGAAGGAGGG - Intronic
910734732 1:90441009-90441031 AAGAAAAGGGAGAAGAGGGAAGG - Intergenic
911228134 1:95330561-95330583 AAGAAAAAGACAAAGAAGTTGGG + Intergenic
911231826 1:95369997-95370019 AAGAACAAGGCAAAGAATGGTGG - Intergenic
911948631 1:104142928-104142950 AAGAAAAAGGAAAGGAAGGAAGG - Intergenic
912089625 1:106055200-106055222 AAGAAAATGGATAAGCAGGCAGG + Intergenic
912143207 1:106757188-106757210 AAGAAAAAAGTGAGCAAGGCTGG + Intergenic
912155344 1:106911845-106911867 AAGGGAAAAGAGAAGAAGGCAGG - Intergenic
912176766 1:107168183-107168205 AAGAAAAAGAGAAAGAAGGAAGG - Intronic
912191573 1:107347017-107347039 AAGAACAAGGCAAAGCAAGCAGG + Intronic
913390572 1:118306852-118306874 AAGGAAAAGGCAAGGAAGCCGGG + Intergenic
913637883 1:120782099-120782121 ACTAAAAAGGTGAAGAAGCCTGG + Intergenic
914215971 1:145628752-145628774 AAGAAGAATGGGAAGAAAGCTGG + Intronic
914280829 1:146170886-146170908 ACTAAAAAGGTGAAGAAGCCTGG - Intronic
914468540 1:147951384-147951406 AAGAAGAATGGGAAGAAAGCTGG + Intronic
914541872 1:148621825-148621847 ACTAAAAAGGTGAAGAAGCCTGG - Intronic
914564984 1:148857662-148857684 AAGAAAGGGGCTAAGATGGCCGG - Intronic
914607840 1:149272580-149272602 AAGAAAGGGGCTAAGATGGCCGG + Intergenic
914624771 1:149449422-149449444 ACTAAAAAGGTGAAGAAGCCTGG + Intergenic
914801610 1:150966567-150966589 AAGTAATAGCCAAAGAAGGCAGG + Exonic
914805908 1:150991529-150991551 AAAAAGAAGAAGAAGAAGGCCGG - Intronic
914840239 1:151242314-151242336 AAGATAAAGGCTCAGAAGGAAGG - Intronic
914840973 1:151248377-151248399 AAAAAAAAGAAGAAGAAAGCTGG - Intronic
915125432 1:153660317-153660339 AAAAAAAAGGCCAGGCAGGCCGG - Intronic
915768367 1:158390913-158390935 GAGAAAAATGTGAAGAGGGCTGG - Intergenic
916203515 1:162294142-162294164 AAGAGAGAGGGGAAGAAGGAAGG + Intronic
916259738 1:162829600-162829622 AAAAAAAAGAAGAAGAAGGAAGG - Intronic
916862474 1:168820994-168821016 AAGAAAAGGGCAAAGAAGGAAGG + Intergenic
916876574 1:168976231-168976253 ATGAAAGAAGTGAAGAAGGCTGG + Intergenic
916884615 1:169054899-169054921 AAGAAAAATGTGTAGAATGCAGG + Intergenic
916923980 1:169498341-169498363 AAGAATGAGGAGCAGAAGGCTGG + Intergenic
917157392 1:172019056-172019078 AAGAAAAAAGGAAAGAAGGGAGG - Intronic
918200067 1:182258343-182258365 AAGAAGAAGGGGAAGAAGGAAGG - Intergenic
918216653 1:182397556-182397578 AAGAAAAAAGAAAAGAAGGAAGG - Intergenic
918233656 1:182558308-182558330 AAGGAAAAGGCCAAGAAAGAGGG + Intronic
918450046 1:184649278-184649300 AAGAAAAAGCCTAACAAGTCTGG - Intergenic
918560119 1:185855414-185855436 AATAAAAAGAAGAAGCAGGCAGG - Intronic
919158482 1:193799104-193799126 AAGAAATAGGCAAAGAAGTAGGG - Intergenic
919523529 1:198619339-198619361 GAGAGAAATGTGAAGAAGGCTGG - Intergenic
919595845 1:199561519-199561541 AAGAAGAAGGAGAAGGAGGAGGG - Intergenic
919631850 1:199966972-199966994 AAGAAAATGGAGAAGAAGCCAGG + Intergenic
919821158 1:201472794-201472816 AAGAAAGATGGGAATAAGGCGGG + Intergenic
919851925 1:201678838-201678860 GAGAAAAAGTCGAAGGAGGAAGG + Intronic
919908046 1:202091804-202091826 AAGAAAAAGAGGAAGAAGGAAGG - Intergenic
919934408 1:202242009-202242031 AGGAAAAAGGTGGAGAAGCCAGG + Intronic
920063269 1:203244069-203244091 AAGAAGAAGGGGAGGAAGGAGGG + Intronic
920154554 1:203937801-203937823 AAGAAAAAGGAAAGGAAGGAAGG + Intergenic
920222064 1:204411401-204411423 AAGAAAAAGGAGATGGAGCCGGG - Exonic
920276140 1:204806256-204806278 AAATAAAAGGGGAATAAGGCTGG + Intergenic
921562500 1:216675369-216675391 AAAAAAAAGGGGGAGAAGGTGGG + Intronic
922570317 1:226630879-226630901 AGGAGAAAGGAGAAGAAGGAAGG + Intergenic
922592839 1:226791519-226791541 AAGAAGAAGAAGAAGAAGGGAGG - Intergenic
922593393 1:226795849-226795871 AAAAAAAAAACAAAGAAGGCCGG - Intergenic
923322806 1:232852661-232852683 AAGAAAAAGGAGAGGAATACAGG - Intergenic
923432483 1:233936652-233936674 AAGAAGAAGGGGAAGAAAGGAGG - Intronic
923694430 1:236233313-236233335 AAAAAAAAAAAGAAGAAGGCTGG + Intronic
924061374 1:240178427-240178449 AAGAAGAAGAAGAAGAAGGGGGG - Intronic
924264079 1:242263132-242263154 CAGAAAAAGGCCAGGCAGGCTGG - Intronic
924433068 1:244013942-244013964 AAGAAGAAGGCCAAGAAAGAAGG - Intergenic
924455729 1:244217576-244217598 AATAAACAGGCTAAGAATGCTGG + Intergenic
924517933 1:244781591-244781613 AGGAAAAAGACAAACAAGGCCGG - Intergenic
924544845 1:245016802-245016824 AAGAATAAGGCAAGGTAGGCAGG + Intronic
924660034 1:246007511-246007533 AAGAAAAGGCAGAAGGAGGCCGG + Intronic
924812301 1:247414063-247414085 AAGAAAATAGAGAAGAAGCCAGG - Intergenic
924889845 1:248263208-248263230 AAAAAATAGGCCAAGAAGGAAGG - Intergenic
1062879422 10:966156-966178 GAGAAAAAGAAGAAGGAGGCTGG + Intergenic
1062942804 10:1437621-1437643 AAGAAATATGGGAAGAAGGGAGG + Intronic
1063057221 10:2518961-2518983 AAGAAGAAGAAGAAGAAGGGGGG + Intergenic
1063058583 10:2527636-2527658 AACAAAAAAGCCAGGAAGGCAGG + Intergenic
1063542594 10:6949482-6949504 AAGGAAGAGGAGAAGAAGGCAGG - Intergenic
1063885236 10:10570532-10570554 AAGAAAAAGGCTAAAATGGGTGG + Intergenic
1064058914 10:12120921-12120943 AAGAAAATGGCCATTAAGGCCGG + Exonic
1064099340 10:12450155-12450177 AGGAAAAAGGGAAAGAAGGAAGG + Intronic
1064212217 10:13369645-13369667 TTGAAAAAGGAGTAGAAGGCCGG + Intergenic
1064402517 10:15033479-15033501 AAGAAAAAGGAGAAGAAAGAGGG + Intronic
1064662408 10:17618753-17618775 AAAAAAAAGGAAAGGAAGGCTGG + Intergenic
1064895284 10:20228573-20228595 AAGAAAAAAGGCAGGAAGGCAGG + Intronic
1065066146 10:21966982-21967004 AAGAAAAAGGTGGGCAAGGCCGG - Intronic
1065163685 10:22951832-22951854 TAGAAAAAGAAGAACAAGGCTGG + Intronic
1066720719 10:38335332-38335354 CAGAAAAAGGCCAGGCAGGCTGG + Intergenic
1066954973 10:42157561-42157583 AAGACAAATGAGAAGAGGGCAGG - Intergenic
1067150654 10:43730039-43730061 AAGAAGAAGAAGAAGAAGACAGG + Intergenic
1067413603 10:46086456-46086478 AAAAAAAAAGGGCAGAAGGCTGG - Intergenic
1068451928 10:57201701-57201723 AAAAAAAAGCAGAAAAAGGCCGG - Intergenic
1068513791 10:58000674-58000696 AAGAAAGAGGAAAAGGAGGCAGG + Intergenic
1068521043 10:58077791-58077813 AAGAAAAAGAAGAAGAAGACAGG + Intergenic
1068867158 10:61906377-61906399 AGGAAAATGGCAAAGTAGGCGGG + Intronic
1069002680 10:63283353-63283375 AAAAAAAAGGCTCAGAAAGCAGG - Intronic
1069107533 10:64401866-64401888 AAGAAAAAGGAGAAAAACTCTGG - Intergenic
1069455390 10:68549924-68549946 AAAAAGAAGAAGAAGAAGGCTGG + Intergenic
1069844303 10:71360120-71360142 AAAAAAAAGAAGAAGAAGACAGG - Intronic
1070037182 10:72737814-72737836 CAGAAAAAGGGGAAATAGGCTGG - Intronic
1070332598 10:75429116-75429138 AAGAACAAGGAGAAGGAGGAGGG - Intergenic
1070508956 10:77142069-77142091 AAGAAAAACCCTAAGTAGGCCGG + Intronic
1070945820 10:80390807-80390829 AAGAAAAACGGGGAGATGGCGGG - Intergenic
1071110774 10:82152766-82152788 AAGGAGAAGGAGAAGAAGGAAGG - Intronic
1071444337 10:85731806-85731828 AAAAAAAAGAAGAAGAAGGAAGG + Intronic
1071568875 10:86685649-86685671 AGGAAAAGGGCAAAGAAGACAGG - Intronic
1072136628 10:92553125-92553147 AAGAAAAAGAAAAAGCAGGCTGG + Intronic
1072453740 10:95559427-95559449 AAGGAAAAGGCCAACAAGGCGGG + Intronic
1072818276 10:98530974-98530996 AAGAAAATGGCCAGGCAGGCAGG - Intronic
1072841355 10:98777750-98777772 AAGAAGAAGGACAAGGAGGCAGG - Intronic
1072907628 10:99469142-99469164 CTGAAAAAGGCTAAGAGGGCAGG - Intergenic
1072907927 10:99472002-99472024 AAGAAAGAGGGAAAGAAGGAAGG + Intergenic
1073513874 10:104060290-104060312 AAGAAAATGGGTAAGAAGGAAGG + Intronic
1074085846 10:110208631-110208653 AGGAAAAAGGCGAAGTAGGAGGG - Intronic
1074959337 10:118426331-118426353 AATAAAAAGGAGTAGAAGGTAGG - Intergenic
1075008263 10:118845999-118846021 AAGAAAAAAGGGAAAATGGCGGG + Intergenic
1075056975 10:119226271-119226293 AAGAAAAAGAAGAAGATGCCAGG - Intronic
1075338017 10:121622738-121622760 TAGAGAAAGGGGAAGAAGGAGGG - Intergenic
1076199692 10:128548044-128548066 AGGAAAAAAGGGAAGAAGGGAGG + Intergenic
1076653012 10:132003086-132003108 AAGAAAAAGGCCAGGCATGCTGG + Intergenic
1078239421 11:9516779-9516801 AAGAACAAGTTGATGAAGGCAGG - Intronic
1079469608 11:20765684-20765706 AAGAAGGAGGCCAAGAAGGAGGG + Intronic
1079841468 11:25406002-25406024 AAGAAAAAGATGAAGACTGCAGG - Intergenic
1079923404 11:26460402-26460424 AAGAAAAAGAAGAAGAAAGGGGG + Intronic
1080454825 11:32408550-32408572 AAGAAAAAAGAAAAGAAGGAAGG + Intronic
1080697493 11:34615507-34615529 AAGAAAAAGTAGAAGAGGCCAGG - Intergenic
1081057824 11:38431990-38432012 AAAAAAAAGAAGAAGAAGCCAGG + Intergenic
1081177894 11:39951390-39951412 AAGACAAAGGGGAAGCAAGCAGG - Intergenic
1081523851 11:43909806-43909828 AAGAAAAAGCCCAAGATGTCAGG - Intronic
1081567761 11:44270387-44270409 AAGGAACAGGAGAAGAAGGAGGG - Intronic
1081586634 11:44389488-44389510 AAGGAAAAGGGGAAGATGCCAGG - Intergenic
1081850980 11:46275005-46275027 AAGAGAAAGAGGAGGAAGGCCGG - Intergenic
1082893881 11:58169697-58169719 AACAAAAAGGAGAAGAAGAAGGG - Intronic
1083840838 11:65303353-65303375 AAAAAAAAACCGAAGAAGGTGGG + Intronic
1083918710 11:65768008-65768030 AAAAAAAAGAAAAAGAAGGCCGG - Intergenic
1084590722 11:70088521-70088543 AAAAAAAAGAAGAAGAAGACAGG + Intronic
1084892310 11:72242641-72242663 AAGAAGAAGAAGAAGAAGACTGG - Intronic
1085235672 11:75013418-75013440 CAGAAAGAGGGGAGGAAGGCAGG + Intronic
1085519097 11:77127782-77127804 AGGGAGAAGGCGCAGAAGGCAGG + Intergenic
1086037930 11:82439300-82439322 AAGGAGAAGCCGGAGAAGGCTGG - Intergenic
1086079574 11:82889397-82889419 AAGAAGAAGGAGAAGGAGGAGGG + Intronic
1086154047 11:83646401-83646423 AAGAGAAAGGGAAAGAAGGAAGG + Intronic
1086737935 11:90329940-90329962 AAGAAGAAGGAGGAGAAGGAGGG - Intergenic
1087225408 11:95593070-95593092 GAGAAAAAGGTGAACAAGGGAGG - Intergenic
1087843276 11:102942271-102942293 AAGGAGAAGGAGAAGAAGCCAGG - Intergenic
1088011157 11:105002420-105002442 AAGAAAAAGGAGAAGGAAGGGGG - Intronic
1088105654 11:106204072-106204094 AAATAAAAGGAGAATAAGGCAGG + Intergenic
1088330918 11:108650541-108650563 AAAAAAAAGGAGCAGGAGGCAGG + Intergenic
1088629228 11:111758293-111758315 AATAAAAGTGCAAAGAAGGCCGG + Intronic
1088744461 11:112794032-112794054 AGGAGAAAGGGGAAGAAGGAAGG + Intergenic
1088765436 11:112971130-112971152 AGGAAAAAGGGGAGGAAGGAGGG + Intronic
1088859513 11:113786576-113786598 AAAAAAAAGAAGAAAAAGGCCGG + Intergenic
1089028605 11:115298376-115298398 AAGAAGAAAGGGAAGGAGGCAGG + Intronic
1089319962 11:117619039-117619061 GAGAGAAAGGCAAAGAAGCCAGG - Intronic
1089470506 11:118716588-118716610 AAAAAAAGGGAGTAGAAGGCCGG - Intergenic
1089744907 11:120609829-120609851 AGGAGAAAGGGGTAGAAGGCAGG - Intronic
1090026555 11:123172405-123172427 AAGAAAGTGGCTAAGTAGGCTGG - Intronic
1090243335 11:125199135-125199157 AGAAAAAAAGGGAAGAAGGCTGG - Intronic
1090395646 11:126416394-126416416 CAGAAAAAGGCGACAGAGGCTGG - Intronic
1090440743 11:126723368-126723390 TAGAAATAGGCAAAGAAGGGAGG + Intronic
1090502983 11:127279783-127279805 AAGAAAAAGAAGAAGAAGAAGGG - Intergenic
1090641737 11:128735102-128735124 AATAAACTGGAGAAGAAGGCAGG - Intronic
1090728026 11:129545024-129545046 AAGAACAAGGGGGAGATGGCAGG + Intergenic
1090960309 11:131550549-131550571 AAGGCGAAGGGGAAGAAGGCAGG - Intronic
1091123181 11:133073895-133073917 AAGAAAAAGGCTTAGAATACTGG + Intronic
1091333213 11:134747087-134747109 AAGAGGATGGCGAAGCAGGCAGG - Intergenic
1091439643 12:502539-502561 AAGAGAAAGGAGAAACAGGCGGG + Intronic
1091465206 12:678070-678092 AAGAAAAAGAAAAAGAGGGCCGG + Intergenic
1092001466 12:5036034-5036056 AAGAAAAAAGAAAAGAAGGAGGG + Intergenic
1092334299 12:7615157-7615179 AAGAAAAGAGGGAAGAAGGAAGG + Intergenic
1092451280 12:8604932-8604954 AAAAAAAAGGAAAAAAAGGCGGG + Intronic
1092764713 12:11842100-11842122 AAGAAGAAGGAGATGTAGGCTGG + Intronic
1092798738 12:12141218-12141240 AAGAAAAAAGGAAAGAAGGGAGG + Intronic
1092818571 12:12332236-12332258 AAGAAAAAGGAAAAGAGAGCAGG - Intronic
1093161052 12:15746995-15747017 CAGAAAAAGGCAAAGAAGAAAGG - Intronic
1093338225 12:17936425-17936447 AAGAAAAAGGCGAACACGCAAGG - Intergenic
1093461101 12:19407596-19407618 AAGAAAAAAGAGATGGAGGCTGG - Intronic
1093973332 12:25394507-25394529 AAAAAAAAGGCGGTGAGGGCGGG - Intergenic
1095173712 12:39065315-39065337 AAGAAAAAGGGGAGAAAGGCTGG - Intergenic
1095326779 12:40904311-40904333 AAGGAAAAAGAGAAGAGGGCTGG - Intronic
1095694476 12:45129192-45129214 AAGAAAAAAGAAAAGGAGGCCGG + Intergenic
1095828763 12:46560181-46560203 ATGAAAATGGAGAAGAAGGCAGG + Intergenic
1096149468 12:49299564-49299586 AAGAAGAAGAAGAAGAAGCCCGG + Intergenic
1096418368 12:51433406-51433428 AAGAAAAAGGAAAGGAAGGAAGG - Intronic
1096447460 12:51706471-51706493 AGGAAGAAGGTGAAGAAGGAGGG + Exonic
1096632086 12:52934263-52934285 AAGGAGAAGGAGAAGAAGCCGGG + Intronic
1096766980 12:53899321-53899343 AGGAAAAAGGAGAAGGAGGGAGG + Intergenic
1097003451 12:55897955-55897977 AAAAAAAAAAAGAAGAAGGCTGG + Intergenic
1097548038 12:61029303-61029325 AAGGAGAAGGAGAAGAAGACAGG - Intergenic
1097986305 12:65786376-65786398 AAGAAAAATGAAAAGAAGGAAGG - Intergenic
1098083192 12:66811948-66811970 GAGAAAAAGGCCGAGAAGGCAGG - Intergenic
1098630174 12:72713341-72713363 AAGAAGGAGGAGAAGAAGGAAGG + Intergenic
1098650649 12:72962979-72963001 AAGAAAAAAGAAAAGAAGGGAGG + Intergenic
1098701310 12:73631187-73631209 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1098783436 12:74718348-74718370 AAGAAGAAGAAGAAGAAGACAGG - Intergenic
1098861272 12:75713109-75713131 ATGAAAAAGGCAAAGATGACCGG - Intergenic
1099201360 12:79681110-79681132 AGAAAAAAGGAGAAGAAGGGAGG + Intronic
1099602773 12:84762219-84762241 AAGAAGAAAGCAAAGAAGGAGGG + Intergenic
1099940277 12:89179165-89179187 ATGAAAGAGGCCAAGAAGCCTGG + Intergenic
1100455973 12:94752136-94752158 AAGAAAAAGGAAAGGAAGGCCGG - Intergenic
1100593910 12:96055359-96055381 AAAAAAAAGAAGAAGAAGCCAGG + Intergenic
1100700240 12:97139656-97139678 AAGATGAAGGGGAAGAAAGCAGG - Intergenic
1101730624 12:107424310-107424332 TAGAGAAAGGAGAAAAAGGCAGG - Intronic
1102158192 12:110747137-110747159 AAAAAAAAGAAGAAGAAGGTGGG + Intergenic
1102745000 12:115242632-115242654 AAGCAAGATGCTAAGAAGGCGGG - Intergenic
1102777677 12:115534823-115534845 AAGAAAAAGGAGGAGTAGGCAGG + Intergenic
1102966760 12:117133605-117133627 AAGAAAAAGGCAGGTAAGGCCGG - Intergenic
1103070209 12:117935122-117935144 AAGAAGAAGAATAAGAAGGCAGG - Intronic
1103552315 12:121746656-121746678 TAGAAAAATGAGAAGAAGGCCGG + Intronic
1103616328 12:122155185-122155207 AAAAAAAAAGAGAAGAAGCCAGG - Intergenic
1103767334 12:123290050-123290072 AAGAAGAAGCCCAAAAAGGCGGG - Exonic
1104085924 12:125474201-125474223 AAGAAAAAAGTAAAGAAGGAAGG - Intronic
1104232486 12:126898637-126898659 AAGAAAGAGGAGAAAAAGGGAGG + Intergenic
1104412529 12:128571237-128571259 AATAAAAAAGGGTAGAAGGCAGG - Intronic
1104703431 12:130924677-130924699 AAGAAGAAGAAGAAGAAGACTGG - Intergenic
1104822391 12:131684606-131684628 AGGAAACAGGCACAGAAGGCTGG - Intergenic
1104923341 12:132302734-132302756 AAGAGAAAGGCCAGGAGGGCAGG + Intronic
1105637209 13:22227180-22227202 AATAAAAAGGCCAAGAGGACTGG + Intergenic
1106176073 13:27333033-27333055 AAGAAGAAGAAGAAGAAGGCTGG + Intergenic
1106253937 13:28005031-28005053 CAGAAAGAGACGTAGAAGGCCGG + Intronic
1106513978 13:30436805-30436827 AAGAAAGAGGAAAAGGAGGCTGG - Intergenic
1107721505 13:43253275-43253297 AAGAAAAAAGGGAAGAAAGGCGG - Intronic
1107930278 13:45301254-45301276 AAGAAAAAGCCGGCTAAGGCAGG + Intergenic
1108038727 13:46320073-46320095 AAGAAAAAGGAGGAAGAGGCCGG + Intergenic
1108168621 13:47718548-47718570 AAGAAAAGGGGGAAGAAAGCAGG + Intergenic
1108328385 13:49358563-49358585 AAGAAAGAGGCAAAGAGGCCAGG + Intronic
1108359270 13:49654279-49654301 AAGAAAGAGGGGAAGAAGGAAGG + Intergenic
1108834401 13:54523293-54523315 GAGAAAAGGGAGAGGAAGGCAGG - Intergenic
1109384705 13:61611163-61611185 AAGGAAAAGAGGAAGGAGGCAGG - Intergenic
1109630587 13:65040241-65040263 AAGAAAAAGATGAAGAAGAGAGG - Intergenic
1109642584 13:65209770-65209792 AAGGCAAAGGGGAAGTAGGCTGG + Intergenic
1110490332 13:76096051-76096073 AAGAAAAAGGGAAGGGAGGCAGG - Intergenic
1110622821 13:77618165-77618187 AAGAAAAAAGGGAGGAAGGGAGG - Intronic
1110744428 13:79036360-79036382 AAGAAAAAGAAAAAGAAGGAAGG + Intergenic
1110744434 13:79036383-79036405 AAGAAAAAAGGGAGGGAGGCAGG + Intergenic
1111043404 13:82782153-82782175 AAGAAAAAAGCAAAAAAGACAGG - Intergenic
1111240419 13:85466237-85466259 AAGACAAAGGGGAAGCAAGCAGG + Intergenic
1112537435 13:100273917-100273939 AAGAAAAAAGGGAAGAAGGAAGG - Intronic
1112574106 13:100620213-100620235 AACAAAAGGGTGAAGAAGCCTGG - Intronic
1112643175 13:101300331-101300353 AAGAAAAAGAAAAAGAAGGAAGG - Intronic
1112766750 13:102753912-102753934 AAGAAAATGCTGAAGCAGGCTGG + Intronic
1112795029 13:103047553-103047575 AAGAAAAAGGGAAAAAAGGAAGG - Intronic
1112968495 13:105229724-105229746 AAGAAAAAGAAAAAGAAAGCAGG - Intergenic
1113010946 13:105765047-105765069 AAGAAAAGGAGGAGGAAGGCAGG - Intergenic
1113898838 13:113784548-113784570 AAGAAGAAGGAGGAGAAGGGAGG + Intronic
1115298874 14:31861565-31861587 AAGAAGGAGGAGAAGAGGGCAGG - Intergenic
1115467110 14:33727623-33727645 AAGAAAAAGAAAAAGAAGGAAGG + Intronic
1116250117 14:42470940-42470962 GAGGAAAAAGCGAAGAAGGTTGG - Intergenic
1116375830 14:44199528-44199550 AAGAAAAAAGGGAAGAAGGGAGG + Intergenic
1117488852 14:56226084-56226106 AAGAAGAAGAAGAAGAAGTCAGG + Intronic
1117981214 14:61343856-61343878 AGGGAAAAGGCAAAGAAGTCAGG - Intronic
1118128578 14:62937006-62937028 AAGAAAGAGGAGGAGAAGGAAGG + Intronic
1118205599 14:63720324-63720346 GAGAAAAAGGAAAAGAAGGATGG + Intronic
1118879949 14:69817446-69817468 AAGAGAAAGGCGAAGGCAGCAGG - Intergenic
1118995350 14:70830577-70830599 GAGAAAAAGGCGAACAGGGACGG + Intergenic
1119260679 14:73236518-73236540 TAAAAAAAGAAGAAGAAGGCTGG + Intergenic
1119328289 14:73775216-73775238 AAGAAAAAGGCCAGAAAGGTGGG + Intronic
1119333781 14:73815324-73815346 AAAAAAAAGAGGAAGAAGGGTGG + Intergenic
1119387788 14:74268658-74268680 AAGAAAGAAGAAAAGAAGGCAGG + Intergenic
1119525016 14:75316093-75316115 AATAAAAAGACCAAGTAGGCTGG + Intergenic
1119625738 14:76173595-76173617 CAGAAAGGGGCGAAGAAGGCTGG + Exonic
1120117158 14:80633466-80633488 AAGACACTGGAGAAGAAGGCAGG - Intronic
1120395958 14:83967002-83967024 AAGAAGAAAGAGAAGAAGGAAGG - Intergenic
1120592740 14:86394986-86395008 AAGAAAAAAAAGAAAAAGGCTGG + Intergenic
1121160451 14:91734425-91734447 CATAAAAAGGATAAGAAGGCTGG - Intronic
1121230182 14:92351871-92351893 AAGAAAAAAGGAAAGAAGGAAGG + Intronic
1121712773 14:96051835-96051857 ATGACAAAGACGATGAAGGCTGG - Intronic
1122238021 14:100343927-100343949 ATGAAAAAGGCAAGGAAGGCCGG - Intronic
1122322255 14:100862120-100862142 AAGGAAGAGGAGAAGAAGGCAGG - Intergenic
1122383306 14:101325935-101325957 TGGCAAAAGGTGAAGAAGGCTGG - Intergenic
1122435746 14:101695494-101695516 AGGAAAAAGGGGAGGGAGGCTGG + Intergenic
1122531665 14:102432107-102432129 AAGAAGAAGAAGAAGAAGACAGG + Exonic
1122570170 14:102692748-102692770 AAGAAAAAGAAAAAGAAGGAAGG - Intronic
1122621645 14:103061128-103061150 AAGAAAAAGAAAAAGAAGGCCGG + Intergenic
1202839742 14_GL000009v2_random:110869-110891 AAGAAAAAGGCAGAGAAAGTTGG + Intergenic
1202841430 14_GL000009v2_random:124825-124847 AGGAAAATGGCGAAGTGGGCGGG + Intergenic
1202909118 14_GL000194v1_random:101009-101031 AAGAAAAAGGCAGAGAAAGTTGG + Intergenic
1202910818 14_GL000194v1_random:115056-115078 AGGAAAATGGCGAAGTGGGCGGG + Intergenic
1124196427 15:27634652-27634674 AAGAAAAAGAGGAAGAGGACAGG - Intergenic
1124919412 15:34011219-34011241 ACGAAAAAGGAAAAAAAGGCAGG + Intronic
1125065894 15:35486134-35486156 AAGGCAAAGGAGAAGCAGGCAGG + Intronic
1125069299 15:35532765-35532787 AGGAAAAAAGGGAAGAAGGGAGG + Intronic
1125311119 15:38379082-38379104 AAGAAGAAGAAGAAGAAGTCAGG - Intergenic
1125713134 15:41803428-41803450 AAAAAAAAGGTTAAGCAGGCAGG + Intronic
1126496377 15:49295147-49295169 AAGAAGAAAGAGAAGAAGGAGGG + Intronic
1126686357 15:51251979-51252001 AAGACAAAGGGTAAGAATGCTGG - Intronic
1127112479 15:55689479-55689501 AAGAAAAAGGGGAGGGAGTCTGG + Intronic
1127149770 15:56061243-56061265 TAAAAAAAGGAAAAGAAGGCTGG + Intergenic
1127272364 15:57413152-57413174 AGAAAGAAGGAGAAGAAGGCCGG - Intronic
1127582320 15:60349760-60349782 AAGAAAAAGGGAAGGAAGGAAGG + Intronic
1127628879 15:60806803-60806825 GACAAAAAGGAGAAAAAGGCAGG + Intronic
1127936603 15:63646503-63646525 AAAAAAAAAACCAAGAAGGCTGG + Intronic
1128024566 15:64424228-64424250 AAGAAAAAGCCAAAGAAAGAAGG - Intronic
1128262510 15:66242433-66242455 AAGAAAAAGAAGAAGAAAGAAGG + Intronic
1128661778 15:69506600-69506622 AAAAAAATAGAGAAGAAGGCTGG - Intergenic
1128741482 15:70086867-70086889 GTGCAAAAGGGGAAGAAGGCAGG - Intronic
1129371981 15:75102949-75102971 AAAGAAAAGACAAAGAAGGCTGG - Intronic
1129440390 15:75577731-75577753 AAGAAAAAGGCAAACCATGCTGG - Intronic
1129858915 15:78845085-78845107 AAGAAAAAAGAAAAGAAAGCTGG - Intronic
1130143795 15:81256207-81256229 TAGAAAAAGGGCAAAAAGGCTGG - Intronic
1130392592 15:83472296-83472318 AAGAGAAGGGAAAAGAAGGCAGG - Intronic
1130435809 15:83898296-83898318 AAGAAAAAGAAGAAGAATGGCGG + Intronic
1130528667 15:84728628-84728650 TAGAAAAAGCAGAAGAGGGCCGG - Intergenic
1130860933 15:87889028-87889050 GAGAAACAGGGGGAGAAGGCTGG - Intronic
1131150384 15:90043869-90043891 AAGAAAAAGGGGAAAAAAGAGGG - Intronic
1131284840 15:91048191-91048213 AAGAAGAAGAAGAAGAAGGAGGG - Intergenic
1132532031 16:456457-456479 AAGAAAAAGAAAAACAAGGCTGG + Intronic
1132778975 16:1612649-1612671 ATGAAAAAGGTGACCAAGGCTGG + Intronic
1133046515 16:3091304-3091326 AACAAAAAGGCCAAAAAGTCAGG + Intronic
1133915595 16:10106742-10106764 AGAAAAAAGGAGAATAAGGCAGG + Intronic
1134019455 16:10911327-10911349 AAGAAAAGGGGGAAGAAGGGAGG - Intronic
1134398214 16:13884944-13884966 AAAAAAAAGAAGAAGAAGGCCGG - Intergenic
1135027818 16:19012490-19012512 TAGAAAGTGGCAAAGAAGGCTGG + Intronic
1135091368 16:19520733-19520755 AAAAAAAAGAAGAAGAAGGAAGG + Intronic
1135179439 16:20260097-20260119 AAGAATGATGAGAAGAAGGCCGG + Intergenic
1135218507 16:20593019-20593041 AAGAGAAAGGAAAAGAAGGAAGG - Intergenic
1135712736 16:24731112-24731134 AAGAAAAAGGGGAATAAGAAAGG - Intronic
1135728185 16:24873192-24873214 AAGGGAAAGGAGAAGAAGGAAGG + Intronic
1135939617 16:26809857-26809879 AAGAAAGAGGGCAAGAAGGAAGG + Intergenic
1136017567 16:27412376-27412398 AAGGAGAAGGAGAAGAAAGCTGG - Intronic
1136360339 16:29775358-29775380 AAGAAAAAAGAAAAAAAGGCCGG + Intergenic
1136484169 16:30560616-30560638 AAAAAAAAGAAGAAGAGGGCCGG + Intergenic
1136570720 16:31094899-31094921 AGGAAAACAGCGAAGAATGCCGG + Exonic
1136676652 16:31914588-31914610 AAGAAAAAGGTGGAAAAGGGAGG + Exonic
1136789240 16:32954975-32954997 AAAAAAAAGGAAAAGAAAGCGGG - Intergenic
1136880573 16:33898963-33898985 AAAAAAAAGGAAAAGAAAGCGGG + Intergenic
1136936684 16:34474214-34474236 AAGACAAATGAGAAGAGGGCAGG - Intergenic
1136947988 16:34678867-34678889 AAGACAAATGAGAAGAGGGCAGG + Intergenic
1136959102 16:34825251-34825273 AAGACAAATGAGAAGAGGGCAGG + Intergenic
1136963135 16:34874356-34874378 AAGACAAATGAGAAGAGGGCAGG + Intergenic
1136967226 16:34928559-34928581 AAGACAAATGAGAAGAGGGCAGG + Intergenic
1137085017 16:36109295-36109317 AAGACAAATGAGAAGAGGGCAGG - Intergenic
1137087838 16:36150670-36150692 AAGACAAATGAGAAGAGGGCAGG + Intergenic
1137219770 16:46437160-46437182 AAGGAAAAGGAAAAGAAGGAAGG - Intergenic
1137221551 16:46456776-46456798 AAGACAAATGAGAAGAGGGCAGG - Intergenic
1137257914 16:46792767-46792789 AAGAAAAAAAAGAAGACGGCCGG + Intergenic
1137266501 16:46873402-46873424 AAGAACAAGGCGTGGGAGGCTGG - Intergenic
1137374701 16:47942644-47942666 AAGAAAAAGAAGAAGAAGAAAGG - Intergenic
1137556991 16:49477122-49477144 AAGAAAAAGGAGGAGGAGGAGGG + Intergenic
1137557141 16:49477641-49477663 AAGAAGAAGGAGAAGAAGGAGGG + Intergenic
1137767725 16:50991059-50991081 AAGGAACAGGAGAAGAAGGAAGG + Intergenic
1138109009 16:54308371-54308393 AAGAAAAATAGAAAGAAGGCTGG + Intergenic
1138913468 16:61431845-61431867 ATGAAAGTGGAGAAGAAGGCCGG - Intergenic
1138933868 16:61695073-61695095 AAAAAGAAGAAGAAGAAGGCCGG - Intronic
1138991624 16:62397206-62397228 AAGAAGAAAGGAAAGAAGGCAGG + Intergenic
1139449578 16:67018736-67018758 AAGAAAAAAGAAAAGGAGGCAGG + Intergenic
1140068649 16:71630089-71630111 AAAAAAAAAGGGAAAAAGGCTGG + Intronic
1140513107 16:75522408-75522430 AATAAAAAGGAGAAAAAGGAAGG - Intergenic
1140578364 16:76199389-76199411 AAGAAAAGAGCACAGAAGGCAGG - Intergenic
1140682246 16:77396787-77396809 AAAAAAAAGGCAATGAAGACTGG - Intronic
1140903589 16:79392214-79392236 AAGAAAAAGAGAAAGAAGGAGGG + Intergenic
1141031061 16:80589001-80589023 AAGAGGAAGGAGAAGAAGACTGG + Intergenic
1141104320 16:81220756-81220778 AAGAAAAATGGGAGGAAGGTTGG + Intergenic
1141802712 16:86322131-86322153 AAGAAAAGGGAAAAGAAGGAAGG - Intergenic
1141941187 16:87277214-87277236 AAAAGAAAGGAGCAGAAGGCCGG + Intronic
1142300607 16:89255761-89255783 AAGTAAAAGGCTAAACAGGCTGG - Intergenic
1142557490 17:789820-789842 AAGAAATAGGGAAAGAAGGTAGG + Intronic
1142899193 17:3001954-3001976 AAAAAAAAGGAGAAGAAGAGTGG - Intronic
1142993527 17:3747603-3747625 AAAAAAAAGACTCAGAAGGCCGG - Intronic
1143075285 17:4337354-4337376 AAGAAAAGGAAAAAGAAGGCTGG + Intronic
1143968901 17:10778219-10778241 GAGAACAAGGCGAAGAAAGATGG + Intergenic
1144360242 17:14485223-14485245 AAGAAGAAGAAGAAGAAGGGGGG + Intergenic
1144431130 17:15192567-15192589 AAGAGAAATGAGAAGAAGGTGGG - Intergenic
1144487539 17:15679639-15679661 AAGAAATAGGCCAAGCTGGCCGG + Intronic
1144694740 17:17295144-17295166 AAGAAAAAAGAGAATGAGGCCGG - Intergenic
1144741624 17:17586176-17586198 AAGAAAAAGAAAAAGAAGGAAGG + Intronic
1144827446 17:18114102-18114124 AAGAAAAAGGACAAGAGGGAGGG - Intronic
1145091131 17:19987020-19987042 AAGGAAAAGGAGAAGAAAGGCGG + Intergenic
1145689559 17:26724381-26724403 AAGACAAATGAGAAGAGGGCAGG + Intergenic
1145847192 17:28050806-28050828 GATAAAAAGTCAAAGAAGGCCGG + Intronic
1145892508 17:28427033-28427055 AAAAAAAACAAGAAGAAGGCTGG + Intergenic
1146119952 17:30183912-30183934 AAGAAAAAGGCCAAGCATGGTGG + Intronic
1146287428 17:31583314-31583336 AAGAAAAAGGAAAGGAAGGAAGG - Intergenic
1146299415 17:31676601-31676623 AAGAAAAATGGGAGGAAGGAGGG + Intergenic
1146759025 17:35460190-35460212 AAGGAAAAGGACTAGAAGGCTGG - Intergenic
1146792806 17:35762340-35762362 AGGAAAGAGGGGAGGAAGGCAGG - Intronic
1146848480 17:36201263-36201285 AAGAAAGAAGCAAAGAAGGAAGG + Intronic
1147298021 17:39500334-39500356 AAAAAAAAGAAGAAAAAGGCTGG + Intronic
1147348315 17:39820127-39820149 AAAAAATAGCCCAAGAAGGCTGG + Intronic
1147355739 17:39894929-39894951 AACAAAAGGAGGAAGAAGGCAGG - Intergenic
1147546049 17:41402630-41402652 AATAGAAAGGGGAATAAGGCTGG + Intergenic
1148014262 17:44509993-44510015 AAAAAAAAAGAGAAGAAGGGAGG + Intergenic
1148545507 17:48515897-48515919 AAGAAAGAGAGGAAGAAGGAAGG + Intergenic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148791747 17:50177092-50177114 GAGGAAAAGGAGAAGGAGGCTGG - Intergenic
1149309487 17:55380133-55380155 AAGAAAAAGGAAAAGAAGGTAGG + Intergenic
1149337824 17:55655346-55655368 AAGAAAAAGGGAAGGAAGGGAGG - Intergenic
1149449578 17:56739169-56739191 AAGAAAAAGGTAAGGAAGGAGGG - Intergenic
1149509371 17:57226125-57226147 AAAAAAAAAGAAAAGAAGGCTGG - Intergenic
1149510967 17:57241138-57241160 AAGGGAAAGGGGAAGAAGGTTGG + Intergenic
1149686632 17:58539299-58539321 CAGAAAAAGGGGATGAAGGTGGG + Intronic
1150151028 17:62808766-62808788 AAGAAATAAGCGATGAAGCCAGG + Intergenic
1150562853 17:66309809-66309831 CAGAGAAAGGAGAAGAAGACAGG + Intronic
1150700919 17:67446239-67446261 AAGAATCAGTCAAAGAAGGCTGG - Intronic
1150702068 17:67456215-67456237 ACCAAAAAGGGGAAGAAGACTGG - Intronic
1150753143 17:67884710-67884732 AAGAAAATGCCTATGAAGGCTGG - Intronic
1150766937 17:68009890-68009912 AAAAAAAAGAAGAAGAAGGTGGG - Intergenic
1150801580 17:68287311-68287333 AAAAAGAAGAAGAAGAAGGCTGG - Intronic
1151560533 17:74867326-74867348 AAAAAAAAGACGACGACGGCCGG + Intronic
1151714218 17:75823280-75823302 AAGAAAGAGGCGGAGGAGGCTGG + Exonic
1151749614 17:76029068-76029090 AAGAAAAAGGCGAGTCAGGGAGG - Intergenic
1151887547 17:76932090-76932112 AAGACAAAGACGAAGAAGGGGGG - Intronic
1152007392 17:77691186-77691208 AAGAAAGAGGAGAGGAAGGAGGG - Intergenic
1152131914 17:78482687-78482709 AAGAAAAAGGCAGACAAGGGTGG - Intronic
1152219506 17:79054866-79054888 AAGGCAAAGGGGAAGCAGGCTGG - Intergenic
1152270061 17:79319309-79319331 AAGGAAGAGGCGAGGAAGGTAGG + Intronic
1152350893 17:79783704-79783726 AAGATAAAGGAGAAGTTGGCTGG - Intronic
1203182830 17_KI270729v1_random:80349-80371 AAGACAAATGAGAAGAGGGCAGG + Intergenic
1153102933 18:1494976-1494998 AAAAAAAAGGCAAAGAAGCCAGG - Intergenic
1153318835 18:3751857-3751879 AAGAAGAAGAAGAAGAAGTCCGG - Intronic
1153372974 18:4341201-4341223 AAGAAAAATGTGAAGAAGAGGGG + Intronic
1153482627 18:5562832-5562854 AATAAACATCCGAAGAAGGCTGG - Intronic
1153806470 18:8712519-8712541 AAGAGAAAGGAGGAGGAGGCGGG - Intronic
1154157177 18:11952764-11952786 AAGAAATTGGTGAAGCAGGCAGG - Intergenic
1154516438 18:15171967-15171989 AAGACAAATGAGAAGAGGGCAGG - Intergenic
1155035673 18:22022930-22022952 AAGAAAAAGGGAAAGAAGTCGGG + Intergenic
1155372818 18:25121252-25121274 AGGAAGAAGAAGAAGAAGGCTGG - Intronic
1155452910 18:25981593-25981615 AAGAAAAAGGGAGACAAGGCCGG + Intergenic
1155937242 18:31766590-31766612 AAGAAAAAGTGAAAGTAGGCCGG - Intergenic
1156182243 18:34618998-34619020 AAGATAAATGCGATGAAGGTTGG + Intronic
1156192747 18:34738568-34738590 AAGAGAAAGGAGTAGAAGGAGGG - Intronic
1156281966 18:35648033-35648055 AAGAAGAAGAAGAAGAAGGAAGG + Intronic
1156508801 18:37617494-37617516 AACAAAAAGGGGAAGAGGGAAGG + Intergenic
1156638234 18:39057279-39057301 AAGAAGAAGAAGAAGAAGCCAGG - Intergenic
1156721743 18:40078639-40078661 AAGAAGAAAGGAAAGAAGGCCGG + Intergenic
1156742146 18:40344173-40344195 TAGAAAAAGGCAAACAAAGCAGG - Intergenic
1156753741 18:40494699-40494721 AAGAAAAAGAAAAAGAAGGAAGG + Intergenic
1157364160 18:47048345-47048367 AGGAAAAAGGTGAGGAGGGCAGG + Intronic
1157849485 18:51034545-51034567 AAGAAAAAGGAAAAAAAGGCTGG - Intronic
1157868493 18:51207699-51207721 AAGAAAAATGAAAAAAAGGCTGG + Intronic
1158087510 18:53670066-53670088 AAGAAAAAGGACAAAAAGGAGGG - Intergenic
1158273138 18:55738163-55738185 AAGAGAAAGGAGTAGAAGACTGG - Intergenic
1158467807 18:57707008-57707030 AAGAAAATGAGGAAGCAGGCCGG + Intronic
1158494656 18:57943480-57943502 AAGAAAAATGAGGAGAAGGAGGG - Intergenic
1158524249 18:58198006-58198028 AGCAGAAAGGTGAAGAAGGCAGG - Intronic
1158570505 18:58593579-58593601 AAAAAAAAGGCAAAAAAGACCGG + Intronic
1158701887 18:59755552-59755574 AAAAAAAAGAAGAAGAAGGCTGG + Intergenic
1159517675 18:69478401-69478423 GAGAAAAAGGAGGAGAAGGAAGG - Intronic
1159770908 18:72544161-72544183 AAAAAAAAGAAGAAGAAGACTGG + Exonic
1159908722 18:74123047-74123069 AAGAAAGAAGGGAAGAAGTCTGG + Intronic
1159977877 18:74738441-74738463 AAAAAAAAGGAGAAGTTGGCCGG + Intronic
1160003138 18:75046713-75046735 AACAAAAAGCCAAAGAAGGGAGG - Intronic
1160925361 19:1542280-1542302 AAGAAAAAGAAGGAGAAGGAAGG - Intergenic
1160975967 19:1792613-1792635 AAGAAAGCGGGGAAGAGGGCTGG + Intronic
1161564032 19:4989635-4989657 AAGAAGAAGAAGAAGAAGACTGG - Intronic
1161740488 19:6018264-6018286 CATAAAAAGGAGATGAAGGCCGG - Intronic
1161914944 19:7221410-7221432 AAGAAGAAGAAGAAGAAGGCTGG + Intronic
1161927593 19:7312817-7312839 AAGAATTAGGGAAAGAAGGCTGG - Intergenic
1162343994 19:10109253-10109275 AAAAAAAAAGTAAAGAAGGCCGG - Intronic
1162404364 19:10464699-10464721 AAGAAAAATGAAAACAAGGCCGG - Intronic
1162484334 19:10949758-10949780 AAAAAAAAAAAGAAGAAGGCCGG + Intergenic
1162485191 19:10956025-10956047 AAAAAAAAAAAGAAGAAGGCCGG + Intergenic
1162583065 19:11542182-11542204 AAGAAGAAGAAGAAGAAGGTCGG - Intronic
1162749337 19:12818986-12819008 TACAAAAAGTCAAAGAAGGCGGG - Intronic
1162820806 19:13222381-13222403 AAAAAAAAAGCCGAGAAGGCTGG - Intronic
1162923023 19:13914627-13914649 AAAAAAAAGGCGATGAGGCCTGG - Intronic
1162950036 19:14065839-14065861 AAGAAGAAGAAGAAGAAGGCTGG + Intergenic
1163137262 19:15321272-15321294 AAGAAAAAGAGAAAGAAGGAAGG + Intronic
1163386661 19:17004200-17004222 TAGAAACTGGTGAAGAAGGCCGG - Intronic
1163555555 19:17990502-17990524 AAGAAAAAGAAAAAAAAGGCCGG + Intronic
1163566452 19:18054674-18054696 AAAAAAAAGAGGAATAAGGCTGG + Intergenic
1163682487 19:18691210-18691232 AAGAAAAAGGAAAAGATGGAGGG + Intronic
1163703960 19:18801527-18801549 AAGAAGAAGAAGAAGAAGGGAGG - Intergenic
1163921184 19:20290393-20290415 GAGAAAAAGGAGAAGAGGCCGGG - Intergenic
1164802346 19:31088139-31088161 AAGAAAAAGAGAAAGAAGGAAGG + Intergenic
1164858312 19:31542575-31542597 AAGAAGAAGAAGAAGAAGACAGG - Intergenic
1164973023 19:32548755-32548777 AAGAAAAAGGTGAATGTGGCCGG + Intergenic
1165258518 19:34594478-34594500 AAGAAAGAGGCGAGCAGGGCTGG - Intronic
1165294421 19:34915293-34915315 AAGAAAAAAGAAAAGAAGGAAGG + Intergenic
1165430603 19:35769713-35769735 AAAATAAAGGCGGAGATGGCAGG - Intronic
1165682442 19:37789471-37789493 AAGAAGAAGAAGAAGATGGCCGG + Intronic
1165794579 19:38511531-38511553 AAGAGAAAGGGACAGAAGGCAGG - Intronic
1165929990 19:39351278-39351300 AACAAAATGGCTAAGAGGGCTGG - Intronic
1165941820 19:39418280-39418302 AAGAAAAAAAAGGAGAAGGCTGG + Intronic
1166197137 19:41214480-41214502 AAGAAAAAGGAAAAGAAAGCAGG - Intergenic
1166329506 19:42069975-42069997 AAGAGAAAGGCGGAGGAGGGTGG + Intronic
1166871828 19:45875924-45875946 AAGAAAAGAGGGAAGAAGGAAGG - Intergenic
1167368730 19:49068194-49068216 TAGAAAAAGGCAGAAAAGGCCGG - Exonic
1167553401 19:50176893-50176915 AAGATAAAGGAGAAATAGGCTGG - Intergenic
1167873689 19:52394133-52394155 AAGAAAAAGGTCAAAGAGGCCGG - Intergenic
1168054207 19:53852568-53852590 AAGAAGAAGAAGAAGAAGGCTGG - Intergenic
1168502060 19:56901013-56901035 TAGGAAATGGCGGAGAAGGCTGG + Intergenic
925094673 2:1186586-1186608 AAGCCAAAGGGGAAGCAGGCAGG + Intronic
925435281 2:3831920-3831942 AAGAGGAAAGTGAAGAAGGCAGG - Intronic
925508471 2:4597081-4597103 AAGAAAAAGGAGGAGGAGGAAGG + Intergenic
925567696 2:5273932-5273954 AACAAAATGGCCAAGAAAGCAGG - Intergenic
925978751 2:9159800-9159822 AAAAAAAAGTCTATGAAGGCCGG + Intergenic
926396599 2:12449191-12449213 AAGAAAAAGATGCAGAGGGCAGG - Intergenic
926650084 2:15334171-15334193 AAGAAAAAGGAGAAGAGAGGAGG - Intronic
926726928 2:16005675-16005697 AAGAAAGAGGAGAAGGAGGGTGG - Intergenic
926753942 2:16221222-16221244 AAGAAAAAAGAGCACAAGGCTGG + Intergenic
926812828 2:16771609-16771631 AAGATAAATGGGAAGAAGGAAGG + Intergenic
926825061 2:16898093-16898115 TAGAAAATGGGGAGGAAGGCTGG - Intergenic
926935352 2:18082022-18082044 AAGAATAAGGCAAACAAGCCTGG - Intronic
927644307 2:24866590-24866612 AAAAAAAAGGCCAAGATGCCAGG + Intronic
928053752 2:28029060-28029082 AAGAAAAAGCCGAAGAGGCCAGG - Intronic
928700793 2:33896577-33896599 AAGATGAAGGCTAAAAAGGCTGG + Intergenic
928704467 2:33933255-33933277 GAGAAAGAAGGGAAGAAGGCAGG - Intergenic
928861297 2:35860484-35860506 AAGAAATAGCACAAGAAGGCAGG - Intergenic
928889866 2:36191588-36191610 AACAAAAAGGCGAAGTAAGAGGG + Intergenic
928925212 2:36571707-36571729 TAGATAAAGGGGAAAAAGGCTGG + Intronic
929072652 2:38049243-38049265 AAGAAAAGGGAGTAGAAGGAAGG + Intronic
929113914 2:38428488-38428510 AAGAAAAAATAGAAGAAGGAGGG - Intergenic
929154970 2:38780966-38780988 AAAAAAAAAAAGAAGAAGGCAGG - Intronic
929531891 2:42757876-42757898 AATAAAAACACTAAGAAGGCTGG - Intergenic
929590410 2:43142165-43142187 TAGAAAAGGGTGAAAAAGGCCGG + Intergenic
929886383 2:45882699-45882721 AAGAGAAAGACGGAGAAGACAGG + Intronic
930405844 2:50954628-50954650 AAGAAAGAAGAGAAGCAGGCAGG + Intronic
930681906 2:54265549-54265571 AGGAGAAAGGGGAAGAATGCAGG + Intronic
930769523 2:55117784-55117806 AAGAAAAAGGCACAGAAGCCAGG + Intergenic
931090464 2:58880574-58880596 AGGAAAGAGGAGAAGGAGGCCGG + Intergenic
931150069 2:59563118-59563140 AAGAAAAAGGTGAAAGAGGTAGG + Intergenic
931169832 2:59790974-59790996 AAGGGAAAGGCGAGGGAGGCTGG + Intergenic
931352773 2:61506931-61506953 ATACAAAAGGTGAAGAAGGCCGG + Intronic
931380230 2:61746059-61746081 AAGAAGAAGGAGAAGAAGAAAGG + Intergenic
931764414 2:65442210-65442232 TAGAAAAAGGAATAGAAGGCCGG + Intergenic
931891941 2:66682812-66682834 AAGGACAAAGAGAAGAAGGCAGG - Intergenic
931928397 2:67100294-67100316 AAGGCAAAGGGGAAGCAGGCAGG + Intergenic
932571181 2:72939184-72939206 AGGCAAGAGGCGAGGAAGGCAGG - Intergenic
932582288 2:72999810-72999832 AATTCAAAGGCAAAGAAGGCAGG - Intronic
932600081 2:73117879-73117901 AAGAAAAAGAAAAAGAAGGCCGG + Intronic
932617818 2:73246642-73246664 AAGAGAGAGGGGAAGTAGGCAGG - Intronic
933224102 2:79725678-79725700 AATAAAAATGTGAAGAAGGATGG - Intronic
933367227 2:81368127-81368149 AAGAAAAGGGGGAAGAAAGGAGG - Intergenic
933538512 2:83608642-83608664 AAGTCAAAGGGGGAGAAGGCAGG + Intergenic
933674331 2:85040491-85040513 AAGAAAAAGGAGAGCAAAGCGGG - Intronic
934056942 2:88259015-88259037 AAGAAAAAAAAGAAGAAGACTGG + Intergenic
934252286 2:90367622-90367644 AAGACAAATGAGAAGAGGGCAGG - Intergenic
934257156 2:91435323-91435345 AAGACAAATGAGAAGAGGGCAGG + Intergenic
934658428 2:96130033-96130055 AAGCAGAGGGAGAAGAAGGCAGG + Intronic
935142920 2:100370265-100370287 AAGAAGAAGGCAGAAAAGGCAGG - Intergenic
935263152 2:101371956-101371978 AAGAAAGAGGTAAAGAAGGGAGG + Intronic
935380272 2:102444732-102444754 AAGGACAAGGCAAAGAAGGTGGG - Intronic
935458761 2:103302639-103302661 AAGAAGAAGAAGCAGAAGGCTGG - Intergenic
935590106 2:104839191-104839213 AAGAAAGAGGCGAAGGAGGGAGG + Intergenic
935942249 2:108252848-108252870 AAGAAAAAGGAGGAGAAGTAGGG + Intronic
935969585 2:108517761-108517783 AAGAAAAAGAGAAAGAAAGCTGG + Intergenic
936133248 2:109865979-109866001 AAGAAAAAGAGAAAGAAAGCTGG + Intergenic
936211449 2:110505506-110505528 AAGAAAAAGAGAAAGAAAGCTGG - Intergenic
936233637 2:110725201-110725223 AGGAAAGAGGGGAAGAAGGAAGG + Intergenic
936420588 2:112360081-112360103 AAGAAAAAGAGAAAGAAAGCCGG - Intergenic
936454600 2:112662737-112662759 AAGACAAAGTCCAAGAAAGCTGG - Intronic
937345966 2:121125482-121125504 AAGGAGAAGGAGAAGAAGGAAGG + Intergenic
937381402 2:121380608-121380630 TACAAAATGACGAAGAAGGCAGG - Intronic
937536799 2:122898864-122898886 AAGTAAATGGAGAGGAAGGCTGG - Intergenic
937611761 2:123870014-123870036 AAAAAAAAAGCAAAGAAGGCCGG - Intergenic
937657444 2:124392703-124392725 AAAAAAAAGGAAAAGAAGGAGGG + Intronic
937683550 2:124670105-124670127 AAGGAAAAGGAAAGGAAGGCAGG - Intronic
938195741 2:129326069-129326091 AAGAAAAAAGAAAAGAAGGAAGG + Intergenic
938457208 2:131474391-131474413 AAAAAAAAGAAGAAGAAGACTGG - Intronic
938516759 2:132016961-132016983 AAGACAAATGAGAAGAGGGCAGG - Intergenic
938779059 2:134568226-134568248 AAGAATAAAGGAAAGAAGGCAGG + Intronic
939777008 2:146400626-146400648 AAGAAAAAGGCAAAGAAAAATGG - Intergenic
939818481 2:146926257-146926279 AAGAAAGAGGAGAAGAAAGAAGG + Intergenic
939990295 2:148872028-148872050 AAGAAAAAGGAGAACAGGGCCGG - Intergenic
940126377 2:150330532-150330554 AGGAAGAAGAAGAAGAAGGCTGG + Intergenic
940216128 2:151305390-151305412 AAGAAAAAGGAGGAGGAGGAGGG + Intergenic
940255456 2:151723738-151723760 AAAAAAAAAACAAAGAAGGCAGG - Intronic
940262502 2:151796301-151796323 AAGAAAAAAGGGAAAAAAGCAGG - Intronic
940804263 2:158168324-158168346 AAGCAAGAGGTGAAGCAGGCTGG + Intergenic
941009341 2:160281615-160281637 GAGAAAAAGGCGAAACAGACTGG + Intronic
941465190 2:165817242-165817264 AAGAAGGAGGAGAAGAAGGAAGG + Intergenic
941852763 2:170200761-170200783 TAGAAAAAAGTGAGGAAGGCAGG + Intronic
942183338 2:173401720-173401742 AAGAAGAAGGGAAAGAAGGAAGG - Intergenic
942207728 2:173638192-173638214 AAGAAGAAGGAGGAGGAGGCAGG + Intergenic
942295893 2:174516883-174516905 AAGAGAAAGGTAAAGAAGGCAGG - Intergenic
942870311 2:180726486-180726508 AAGAAAGAGGCACACAAGGCAGG - Intergenic
943464958 2:188217867-188217889 AAGAAAAGGGAGCAGGAGGCTGG - Intergenic
943577136 2:189643072-189643094 AAAAAAAAGGAGAAGGAGGGAGG - Intergenic
944364277 2:198898264-198898286 AAGAAAAGAGAGAAGAAGGAAGG + Intergenic
944548652 2:200824658-200824680 AAAAAAAAGCCTAAAAAGGCTGG - Intergenic
945009392 2:205445458-205445480 AAGGCAAAGGGGAAGCAGGCAGG + Intronic
945194038 2:207221555-207221577 AGGAAAAAGGGAAAGAAGGGAGG + Intergenic
945975193 2:216265002-216265024 AAGAAACAGGGGAAGATGACTGG + Intronic
946076651 2:217079211-217079233 TACAAAAAGGAGAAGAAGGAGGG + Intergenic
946092413 2:217240452-217240474 AAAAAAAATGCGGAGAGGGCTGG - Intergenic
946273631 2:218614445-218614467 AATAAAAAGAGGAAAAAGGCTGG - Intronic
946288637 2:218725850-218725872 AAGAAATAGGCAAATAAGGCTGG - Intronic
946687975 2:222290932-222290954 AAAAAAGAGGAGAAGAAGGGGGG + Intronic
946933862 2:224699339-224699361 AAGAAAAAGACAAAGAAGAAGGG - Intergenic
946934815 2:224709040-224709062 AAGAAAAAGAAAAAGAAGCCAGG - Intergenic
947253372 2:228134279-228134301 AAGAAACAGAGGAAGAAAGCAGG + Intronic
947543344 2:230993438-230993460 AAGAAGAAGAAGAAGAAGGTGGG + Intergenic
947898268 2:233695418-233695440 AAAAAGAAGAAGAAGAAGGCCGG - Intronic
947977112 2:234376289-234376311 AAGAATAAAGGGAAGAAGGGAGG - Intergenic
948568443 2:238901270-238901292 GAGCAAAAGGCAAAGGAGGCCGG - Intronic
948999697 2:241606214-241606236 AAGACAAAGGCCAAGCAGGAAGG - Intronic
1168916639 20:1493676-1493698 AAGAAAAAGAGGGAGAAGACAGG - Intergenic
1169144993 20:3246603-3246625 AAGAAAAAAGAGAAAAAGACAGG - Intergenic
1169211677 20:3769165-3769187 CAGAAAGAGGCGGAGGAGGCAGG - Intergenic
1169792364 20:9425025-9425047 AAGACAAAGGAGAAGGAGGAAGG - Intronic
1169898898 20:10533603-10533625 AAAAAAAAGGCCAAGAATGGTGG - Intronic
1170147075 20:13187451-13187473 TATAAAAAGACAAAGAAGGCCGG + Intergenic
1170402326 20:16001367-16001389 AAGAAAAAAGAGAAAAAGGGAGG + Intronic
1170759578 20:19237802-19237824 AGGAAAAAGGGGGAGCAGGCTGG - Intronic
1171857588 20:30361543-30361565 AGGAAATAGGTGAAGAAGGGAGG + Intergenic
1171944288 20:31362619-31362641 AAGAAAAAAGGGACCAAGGCAGG + Intergenic
1172086620 20:32389576-32389598 AAGAAAAAGGCGGGGCAGGGGGG - Intronic
1172121505 20:32601637-32601659 AAGAGAAGGGCGGAGAAGGGCGG + Exonic
1172154291 20:32812855-32812877 AAGAAAGGGGAGAAGTAGGCAGG - Intergenic
1172470658 20:35192055-35192077 AAGAAAAAGACAAACAAGGAAGG + Intergenic
1172545147 20:35754939-35754961 AAGAAGAAGAAGAAGAAAGCAGG - Intergenic
1172581763 20:36053890-36053912 AAGAAAAAGAAAAAGAAAGCAGG - Intergenic
1172764433 20:37343805-37343827 AAGAACAAGGCGAGGTAGCCAGG + Intergenic
1172775947 20:37407061-37407083 AAGAAAAAAGCAAGGAAGGCGGG - Intergenic
1172824937 20:37773877-37773899 AAGAAAAAGAAGAAAAAGACAGG - Intronic
1172928640 20:38564908-38564930 AAGAAGAAGAAGAAGAAGGGAGG - Intronic
1173163916 20:40672617-40672639 AAGAAAAAGAAGAAGAAGGTGGG + Intergenic
1173775124 20:45698979-45699001 AAGAAGAAGGAGGAGAAGGAGGG + Intronic
1173782442 20:45767729-45767751 AATAAAAAGGAGAAGGAGGAAGG + Intronic
1173912609 20:46681436-46681458 AAGAAAGAGGGGAAGGAGGGAGG + Intronic
1173975331 20:47182637-47182659 AAAAAAAAGGTTAAGATGGCTGG + Intronic
1174377602 20:50136738-50136760 AAAAAAGAGGGGAGGAAGGCTGG + Intronic
1176628473 21:9115722-9115744 AAGAAAAAGGCAGAGAAAGTTGG + Intergenic
1176630170 21:9129753-9129775 AGGAAAATGGCGAAGTGGGCGGG + Intergenic
1176645522 21:9345571-9345593 AAGAAAAAGGCAGGGAAAGCTGG - Intergenic
1176721412 21:10396801-10396823 AAAAAAAAGGAGAAGAAGGCTGG + Intergenic
1177051045 21:16234346-16234368 AAGGAAAAGTAGAAGATGGCGGG - Intergenic
1177115953 21:17087640-17087662 AAGAAAAAGGAGGAGGAGGAGGG + Intergenic
1177973020 21:27813778-27813800 AAGGAAAAAGAGAGGAAGGCTGG + Intergenic
1178008770 21:28257639-28257661 AAAAAGGAAGCGAAGAAGGCTGG - Intergenic
1178092521 21:29179643-29179665 ACTAAAGAGGCAAAGAAGGCAGG + Intergenic
1178122323 21:29481767-29481789 AAATAAAAGGGGAAGCAGGCTGG - Intronic
1178307541 21:31503096-31503118 AGGAAAATGGTGAAGAAGGCTGG + Intronic
1178691672 21:34755064-34755086 CAGGAAAAGGAGAAGAAGGAAGG + Intergenic
1179008787 21:37537180-37537202 AAAAAAAAGGGGAAGAAAGGTGG + Intergenic
1179185399 21:39081804-39081826 AAGGAGAAGGAGAAGAAGGAGGG + Intergenic
1179200844 21:39219127-39219149 AAAAATAAGGAGAAGCAGGCAGG + Intronic
1179423369 21:41253606-41253628 AAGAAGCAGGAGGAGAAGGCAGG + Intronic
1179632256 21:42685762-42685784 AAGAAAAAAGAAAAAAAGGCCGG - Intronic
1179675992 21:42982431-42982453 AAGAAAAAGGAGCATAAGGCCGG + Intronic
1180302603 22:11049577-11049599 AAAAAAAAGGAGAGGAAGGCTGG + Intergenic
1180751919 22:18130634-18130656 AAGAGAAAGTGGAAGCAGGCAGG - Intronic
1180960731 22:19761174-19761196 AAGAAGAACGCGAAGGTGGCCGG + Exonic
1181225900 22:21390592-21390614 AAAAAAACGGAAAAGAAGGCCGG - Intergenic
1181252733 22:21544221-21544243 AAAAAAACGGAAAAGAAGGCCGG + Intergenic
1181389236 22:22567631-22567653 AAGAAAAAGAAAAAGAAGGTGGG - Intergenic
1181469662 22:23130157-23130179 AAGAAAAAGAAAAAGAAGGCCGG + Intronic
1181554601 22:23661390-23661412 AAAAAAAATGCAAAAAAGGCCGG - Intergenic
1181716985 22:24738158-24738180 AAGAAAAAGAAAAAGAAGGAAGG + Intronic
1181789220 22:25250507-25250529 AAGAGAAAGGGAAAGAAGGAAGG - Intergenic
1181831159 22:25561829-25561851 AAGAAAAAGGGAAAGAAGAGGGG + Intergenic
1181886013 22:26023003-26023025 AACAAAAAGGCGAGATAGGCTGG - Intronic
1181896385 22:26111583-26111605 AAAAAGAAGGAGAAGAAGGAGGG - Intergenic
1181976026 22:26730564-26730586 AAGAAAAAGGTGCATAGGGCAGG + Intergenic
1182015495 22:27036048-27036070 AAGAAGAAGAAGAAGAATGCAGG - Intergenic
1182194244 22:28498145-28498167 AAAAAAAAGGCAAAAAAGGTGGG + Intronic
1182202282 22:28585983-28586005 AAAAAAAAGAAGAAGAAGCCGGG + Intronic
1182367969 22:29791381-29791403 AAGAAGAAGAAGAAGAAGGCTGG + Intronic
1183080356 22:35452032-35452054 AAGAAAAAAGGGCAGAAGCCAGG - Intergenic
1183091080 22:35522621-35522643 AAGAAAGAGAGGAAGAAGGAAGG - Intergenic
1183257335 22:36770968-36770990 AAGAAAAAGGAGAAGCAGGCGGG - Intronic
1183288501 22:36982916-36982938 AAGAACAAGAGGAAAAAGGCTGG - Intergenic
1183336136 22:37247711-37247733 AACTAAAAGGCGAGGAGGGCTGG - Intergenic
1183389003 22:37533135-37533157 AAGAAAAAAGAAAAGAAGGCGGG + Intergenic
1184234679 22:43176746-43176768 AAAAAAAAGGAAAAGAAGGAGGG + Intronic
1184448852 22:44571007-44571029 AAGAAAAGGGCCACGAAGGCAGG + Intergenic
1184514830 22:44955556-44955578 AACAAAAAGGCGGGGAAGGGTGG + Intronic
1184794679 22:46725025-46725047 AAAAAAAAGAAAAAGAAGGCTGG + Intronic
1184819212 22:46896182-46896204 AAGAAAAATGGGCAAAAGGCAGG - Intronic
1185304942 22:50109852-50109874 AAGAGAAAGGAAAAGGAGGCTGG + Intronic
1203325638 22_KI270738v1_random:13100-13122 AAGACAAATGAGAAGAGGGCAGG - Intergenic
949137777 3:590254-590276 AAGAAGAAGGCCAATAAGTCTGG - Intergenic
949376124 3:3392304-3392326 AAGAAAAAGGCAAAGGAAGATGG + Intergenic
949747616 3:7312905-7312927 AAAAAAAAGGAGGAGAAGGCAGG - Intronic
949901829 3:8821509-8821531 AGGAAGAAGGCCAGGAAGGCAGG - Intronic
950035626 3:9883157-9883179 AAAAAAAAAAAGAAGAAGGCCGG - Intergenic
950284230 3:11732279-11732301 AAGAAGAAAGGGAGGAAGGCAGG - Intergenic
950512012 3:13435495-13435517 AAAAAATAGGCAAATAAGGCTGG + Intergenic
951037382 3:17948809-17948831 AAGAAAGAGCAGAGGAAGGCAGG - Intronic
951206093 3:19927105-19927127 AATAGAAAGACGAAGAAGGAAGG - Intronic
951591451 3:24269908-24269930 CAGAAAAAGCCAAAGAAGGAAGG - Intronic
951651900 3:24959786-24959808 AAGAACAAGGGGAATGAGGCAGG + Intergenic
951682064 3:25305273-25305295 AAGGAAAAAGAGAAAAAGGCTGG + Intronic
951682214 3:25306522-25306544 AAGAAAAAGAAGAAGAAAGGAGG + Intronic
952165175 3:30740117-30740139 AAGAAGAAAGCAAAGCAGGCAGG + Intronic
952377458 3:32779688-32779710 AAGAAAAAGGCTAAGTAGGAAGG - Intergenic
952569211 3:34694402-34694424 AAGGGAAAGGGGAAGAAGGAAGG - Intergenic
952920023 3:38277661-38277683 ATGAGAAAGGTGAAGGAGGCCGG - Exonic
953148047 3:40297029-40297051 AAGAACAGGGAGAAAAAGGCAGG - Intergenic
953170266 3:40500658-40500680 AAGAAAAAGACAAAGAAGAGAGG + Intergenic
953222123 3:40981622-40981644 AAGAAAAAGAAAAAAAAGGCTGG - Intergenic
953243804 3:41172766-41172788 GAGAAAAGGAGGAAGAAGGCAGG - Intergenic
953604746 3:44404433-44404455 CAGAAAAAGGCTAAGGAAGCAGG - Intronic
953973928 3:47368513-47368535 AAGAAAAAAGGAAGGAAGGCAGG - Intergenic
954602128 3:51878098-51878120 TGGAAAAAGGAGAAGAAAGCAGG + Intergenic
954608034 3:51928948-51928970 TGGAAAAAGGAGAAGAAAGCAGG + Intergenic
954804144 3:53205849-53205871 AAGAAATAGGAGAAATAGGCTGG + Intergenic
954919603 3:54178525-54178547 AAGAAAAAGGCGAAGTTGAGTGG + Intronic
955072424 3:55583366-55583388 AAGAAAGAAGGAAAGAAGGCAGG - Intronic
955307450 3:57848549-57848571 AAGAAAAAGGAGAAGGAGGGAGG - Intronic
955314644 3:57926320-57926342 AGGAGGAAGGGGAAGAAGGCTGG - Intronic
955424682 3:58776036-58776058 CAGAAAAGGGAGAGGAAGGCTGG - Intronic
955731873 3:61995763-61995785 AAGAAAAAGAAAAAGAAGGAGGG - Intronic
955816853 3:62852782-62852804 AAGAAAAAAGCAAACAAGGATGG - Intronic
956175582 3:66470470-66470492 AACAAAAAGGCCAAGAAGTCAGG + Intronic
956198803 3:66683940-66683962 AAGAAAAAGGAGGAGGAGGAGGG - Intergenic
956525173 3:70151210-70151232 AAGAAAAAGGGGAAGAAGTTGGG + Intergenic
956732054 3:72205240-72205262 AGGAAAAAGGGGAGGAAGGAAGG + Intergenic
956863546 3:73347859-73347881 ATGAAAAAAGGGAAGAAGCCGGG - Intergenic
956960387 3:74392399-74392421 AAGAAAAAGAAGAAGCAGGGTGG - Intronic
957094686 3:75767938-75767960 AAGAAAAAGGCAGAGAAAGTTGG + Intronic
957521435 3:81323544-81323566 AAGAAAAAAGGGAAGAAAGGAGG + Intergenic
957842754 3:85692931-85692953 AAGAAAAATCAGAAGGAGGCCGG + Intronic
958111836 3:89157867-89157889 AAAAAAAAGGGAAAGAAGTCAGG + Intronic
958137841 3:89519356-89519378 AAGAAAAAAGAAAAGAAGGGAGG - Intergenic
958181589 3:90067504-90067526 AGGAAAAAGGGAAAGAAGGAAGG + Intergenic
958425015 3:93969755-93969777 AAGAAAAAAGAGAGGAAGGAAGG - Intronic
959174158 3:102884264-102884286 AAGAAAAAGGAAAAGAAGAAAGG - Intergenic
959312971 3:104764051-104764073 AAGAAAGAGGCTAGGAAGGGAGG + Intergenic
959807268 3:110571377-110571399 AAGAAAAAAGGAAAGAAGGAAGG + Intergenic
959913130 3:111787661-111787683 AGGAAAAAGAGGAAAAAGGCAGG - Intronic
959951159 3:112181936-112181958 AAGACAAAGCTGAAGTAGGCAGG + Intronic
960096535 3:113695984-113696006 CAGGAAAAGGTGAAGGAGGCGGG + Intronic
960097127 3:113699291-113699313 CAGGAAAAGGTGAAGGAGGCGGG - Intergenic
960313664 3:116149254-116149276 AACAATATGGGGAAGAAGGCTGG + Intronic
960350383 3:116585757-116585779 AAGAAAGAGGAGAAGGAGGAGGG + Intronic
960386453 3:117026855-117026877 ATGAAAAAGTGGAAGAAGGTGGG + Intronic
960474409 3:118106816-118106838 AAGAAAATGGTGAAGCAGGGAGG - Intergenic
960680169 3:120239391-120239413 AAGAAGAAGAAGAAGAAGGGAGG - Intronic
960911471 3:122653346-122653368 AAGGAAAAGGAAAAAAAGGCAGG + Intergenic
961299063 3:125910333-125910355 AAAAAAAAGGAAAAGAAGGGAGG + Intergenic
961703085 3:128762259-128762281 ATGAAAAAGGCTAAGGAGGAGGG + Intronic
961861652 3:129921202-129921224 CAGAACAAGGAGAAGACGGCTGG + Intergenic
961879406 3:130050281-130050303 AAGAAGAAGGAGAAGAAGGAAGG + Intergenic
963235580 3:142952790-142952812 AACAAAAAGCAGCAGAAGGCAGG - Intronic
963410110 3:144916651-144916673 AAGAGAGAGGTGGAGAAGGCAGG + Intergenic
963583725 3:147158492-147158514 TAGAAAGAAGGGAAGAAGGCAGG + Intergenic
963607544 3:147423973-147423995 AAGAAAAAGCTGGAGAAGGATGG + Intronic
963831228 3:150011801-150011823 AAGAAGAAGAAGAAGAAGGCCGG + Intronic
964236002 3:154528592-154528614 AAGAAAAAGGAAAAGGAGGAAGG - Intergenic
964374424 3:156035552-156035574 AAGAAAGAGAAGAAGAAGGAGGG - Intergenic
964637029 3:158869415-158869437 AAGAAGAAGACGAAAAAGGAGGG - Intergenic
964721887 3:159775522-159775544 GAGAGAAAGGCGAAACAGGCAGG - Intronic
965124449 3:164607511-164607533 AAGAAACAGGCAAAGAAGACAGG - Intergenic
965188545 3:165498999-165499021 AAGAAAAAAGAAAAGAAGGGAGG + Intergenic
965355452 3:167667382-167667404 AAGAAGGAGGGGAAGAAGGAAGG + Intergenic
965492015 3:169349227-169349249 AAGAAAAAGAGCAAGAAGGAGGG - Intronic
965611359 3:170547131-170547153 GAGGAAAAGGAGAAGAAGGAAGG - Intronic
965611540 3:170549203-170549225 AAAAAAAAAAAGAAGAAGGCCGG - Intronic
965617141 3:170606102-170606124 AAAAAAAAGAAGAAGAAGGAAGG - Intronic
965938051 3:174139623-174139645 AATAAAAAGGGGAAAAATGCTGG + Intronic
966073012 3:175902753-175902775 AAGAAAAAGGTGAATATAGCAGG - Intergenic
966428064 3:179802236-179802258 AAGAAAAAAGAAAAGCAGGCTGG + Intronic
966564433 3:181360760-181360782 AAGAAGAAGAAGAAGAAGGAAGG + Intergenic
966705276 3:182906790-182906812 AAGAAGAAGAAGAAGAAGGCCGG + Intronic
967099166 3:186201626-186201648 AACACAAAGGGGAAGATGGCTGG - Intronic
967198238 3:187048237-187048259 AAGAAAAAAGCCAATCAGGCTGG - Intronic
967424146 3:189307017-189307039 AACAAAAAGAAGAAGAAGACTGG - Intronic
967729745 3:192896354-192896376 CAAAAAAAGGCGAAGGACGCTGG - Intronic
967853393 3:194098624-194098646 AAGAAAGAGGAGAGGAAGGGAGG + Intergenic
968210619 3:196845648-196845670 AAAAAAAAGAAGAAGAAGGCCGG - Intergenic
1202741366 3_GL000221v1_random:59497-59519 AAGAAAAAGGCAGGGAAAGCTGG + Intergenic
968777011 4:2548365-2548387 AAAAAATAGGCAAAGTAGGCCGG - Intronic
968914481 4:3491333-3491355 AACAAGCAGGCGAAGAAGGAAGG - Intronic
969823717 4:9740263-9740285 AAGCAGAAGGAGAAGAAGGAAGG - Intergenic
970099141 4:12501318-12501340 AAGGAAGAGGAGAAGAAGGAAGG + Intergenic
970444467 4:16112587-16112609 AGGAAAATGGGGAAGAAGGAAGG + Intergenic
970838005 4:20434189-20434211 ACGAAAATGGGGAAGGAGGCTGG + Intronic
971386481 4:26145011-26145033 AAAAAGAAGAAGAAGAAGGCAGG - Intergenic
971400923 4:26274637-26274659 AAAAAAAAGAAGAAGAAGGCTGG + Intronic
971420268 4:26467987-26468009 AAGAAGAAGAAGAAGAAAGCGGG + Intergenic
971790137 4:31159593-31159615 AAGAAAGAAGAGAAGAAGGCAGG + Intergenic
971914045 4:32844210-32844232 AATTAAAAGGTGAAGAAGACAGG + Intergenic
972059551 4:34852335-34852357 TAGAAAAAGAGGAAGACGGCCGG - Intergenic
972316344 4:37929875-37929897 AAGAAAAAGGAGGAGAAAGATGG + Intronic
972378592 4:38497809-38497831 AAGAAAAATGGGGAGAAGGAAGG + Intergenic
973399504 4:49626650-49626672 AGGAAAATGGCGAAGTGGGCCGG + Intergenic
973972436 4:56226795-56226817 AAGAAAGAGGGAAGGAAGGCAGG - Intronic
974234479 4:59162978-59163000 AAGTAAAAGGCATAGAGGGCTGG + Intergenic
974438502 4:61886941-61886963 ATAAAATAGGCAAAGAAGGCTGG - Intronic
974695435 4:65363103-65363125 GAGAAAGAGGCAATGAAGGCAGG + Intronic
974745773 4:66073817-66073839 AAGAGAAAAGAGAAGAAAGCAGG - Intergenic
974803602 4:66851621-66851643 AAGTAAAAGGCCAAGGATGCAGG + Intergenic
974936326 4:68413313-68413335 AAGAAAGTGGAGAGGAAGGCTGG + Intergenic
975430206 4:74281006-74281028 AAGAAAAAAGGGAGGAAGGGAGG - Intronic
975647098 4:76555887-76555909 AAGAAAAAAGAAAAAAAGGCAGG - Intronic
975783332 4:77862550-77862572 AAGAAAAAGAATAAGAAGGAAGG + Exonic
976072682 4:81259717-81259739 AAGAAAAAGACTAGGAAAGCAGG - Intergenic
976232817 4:82863174-82863196 AAGAAAAAGGGAAAAAACGCTGG + Intronic
976267185 4:83195446-83195468 AAGAGCAAGGAGAAGAGGGCGGG - Intergenic
976463996 4:85347066-85347088 TAGAAAAATGCTAAAAAGGCCGG + Intergenic
977118186 4:93060593-93060615 TAGAAATAGCCAAAGAAGGCAGG + Intronic
978157786 4:105509372-105509394 AAGGAAAAGGAGAGGAAGACAGG + Intergenic
978184173 4:105837382-105837404 AAGAAAAAGGTGAGGTAAGCAGG - Intronic
978277343 4:106967871-106967893 AAGCAAAAGGAGAAGAAGGAAGG + Intronic
978404542 4:108365107-108365129 AAGAAGAAACAGAAGAAGGCAGG + Intergenic
978449073 4:108809748-108809770 AAGAAAAATGGGAAGAAGTAGGG + Intergenic
978502418 4:109423502-109423524 AAGTCAAAGAGGAAGAAGGCAGG - Intergenic
978769127 4:112435416-112435438 AAGAAAAAGGAGTAGAAATCTGG - Intronic
978976005 4:114873886-114873908 AATAACAACGCTAAGAAGGCAGG - Intronic
979405014 4:120299168-120299190 AAGAAAAAGGAGAAAGAGGAAGG - Intergenic
979647629 4:123090012-123090034 GAGAAACAGGCAAAGAAAGCAGG - Intronic
979853542 4:125603389-125603411 AAGGAGAAAGGGAAGAAGGCAGG + Intergenic
980061471 4:128134806-128134828 ATGAAAATGGCTAATAAGGCTGG + Intronic
980578048 4:134711201-134711223 AAGAACTAGGAAAAGAAGGCAGG + Intergenic
980833034 4:138154741-138154763 AAGAAGAAGAAGAAGAAGGATGG - Intergenic
981756520 4:148146077-148146099 AAGAAGAAGGGGAAGTGGGCTGG + Intronic
981766000 4:148250922-148250944 AAGAAAAAGGTGATGGAGACTGG - Intronic
982183935 4:152777611-152777633 AAGAAAAAGAGGAAGAAGGAAGG + Intronic
982237132 4:153262081-153262103 AATAAAAAGCCTAAGAAGGTTGG - Intronic
982338698 4:154270512-154270534 AAGAAGAAGGTGGAGATGGCAGG + Intronic
983019134 4:162653529-162653551 AAGAAAAAGGACAAGGAGGTTGG - Intergenic
983450336 4:167902063-167902085 AGGAACAAGGCAAAGATGGCTGG + Intergenic
983654901 4:170073037-170073059 AAGCAAAAGGCTAAGAAGAAAGG + Intronic
984324371 4:178233270-178233292 AAAAAAAAAGCGAAGGGGGCAGG + Intergenic
984599195 4:181706654-181706676 AACAAACAGGCGAAGGAAGCTGG + Intergenic
984632567 4:182076187-182076209 AAGAAGAAGGAGAAAGAGGCTGG - Intergenic
984834179 4:184003889-184003911 AAGAAGAAAGGAAAGAAGGCAGG - Intronic
984886609 4:184455287-184455309 AAAAAAAAGAAGAAGAAGGAAGG - Intronic
984889587 4:184479152-184479174 AAGAAAACGTCTTAGAAGGCTGG - Intergenic
985179336 4:187239571-187239593 AAAAAAAAGGAAAGGAAGGCAGG - Intergenic
985279564 4:188271794-188271816 AAAAAAAAGAAGAAGAAGGGAGG - Intergenic
985988927 5:3539154-3539176 AAGGACAAGGGGAAGAAGGCTGG - Intergenic
986316429 5:6591706-6591728 AAGAAAAAAGGATAGAAGGCTGG - Intergenic
986453428 5:7890236-7890258 AAGAAAAAGGAGGAGAAATCAGG - Intronic
986731944 5:10641205-10641227 AAGAAGAAGAAGAAGAAGACTGG - Intronic
987047919 5:14124828-14124850 AAAAAAATGGAGAAGGAGGCCGG + Intergenic
987452596 5:18104892-18104914 AAGAAAAAGGAAAAAAAGGGGGG - Intergenic
987811419 5:22840960-22840982 AAGAACAAGGGGAAGGATGCAGG + Intronic
988213325 5:28237823-28237845 AAGAAAAAAGAAAAGAAGGAAGG - Intergenic
988857499 5:35243197-35243219 AAAAAGAAGGCAAAGTAGGCTGG + Intergenic
988954983 5:36306600-36306622 AAGAAAAAAGGAAAGAAGGAAGG - Intergenic
989380328 5:40804056-40804078 AATAAAAAAGTAAAGAAGGCCGG + Intergenic
989796344 5:45478825-45478847 AAGAATAAGCTGAAGAAGGCAGG + Intronic
990181890 5:53170260-53170282 AAGAAAAATGTGAAAAAGTCTGG + Intergenic
990362473 5:55034716-55034738 AAGAAAGAGAAGATGAAGGCCGG + Intergenic
990639617 5:57767414-57767436 AAGAAAAAGGCAAATATGGTTGG - Intergenic
990864856 5:60369125-60369147 AAAAAAAAGGCATAGAAAGCAGG - Intronic
990979847 5:61592722-61592744 AAGAAAATGGTGAAGGATGCTGG + Intergenic
991027060 5:62041169-62041191 AAGAAGAAGGGGAAGAAGTAGGG + Intergenic
991435685 5:66595976-66595998 AAGAAAACGGACAAGAAGGAGGG - Intergenic
991494280 5:67212227-67212249 AAGAAAAAGGCCAAGTAAGAGGG - Intergenic
991520821 5:67494940-67494962 AAGAAAAAGTGGAAACAGGCTGG + Intergenic
991713633 5:69431798-69431820 AAGAAAATGGGGAGGAAGACAGG - Intronic
992023000 5:72643360-72643382 AAGAAGAAGCCAAAGAAGGGAGG - Intergenic
992553239 5:77879410-77879432 AGTAAAAAGATGAAGAAGGCAGG - Intergenic
992617879 5:78562772-78562794 AAAAAAAAGACAGAGAAGGCTGG + Intronic
992861813 5:80918949-80918971 AAGAAAAAAGTGAAGGAGGAAGG + Intergenic
993012657 5:82501081-82501103 AAGAAAAAGGGAAGGAAGGGAGG - Intergenic
993199800 5:84800755-84800777 AAGAAAAAGAAAAAGAAGGAAGG + Intergenic
993343234 5:86751111-86751133 AAGAAAAAGGCAAAGAAAAAAGG - Intergenic
993373510 5:87120405-87120427 AATAAAAAGACCATGAAGGCAGG + Intergenic
994130839 5:96225893-96225915 AAGAAAAAGGAGAAGAAGAATGG - Intergenic
994390512 5:99187033-99187055 AAGAAAAAGGAAAAGAAAACTGG - Intergenic
994439365 5:99783278-99783300 AGGAAAAAGGCAAAGAAGAAAGG - Intergenic
994748352 5:103707236-103707258 AAGAAGAAAGCGCAGCAGGCGGG + Intergenic
995405269 5:111787613-111787635 AAAAAAAAGGTGAAGAAATCAGG + Intronic
995506741 5:112868694-112868716 AATAAAAATGTAAAGAAGGCCGG - Exonic
995969416 5:117949782-117949804 AAGAAAGAGGGGAGGAAGGAAGG + Intergenic
996361818 5:122656978-122657000 AAGAAAGAAGCCAAGAAGCCAGG + Intergenic
996576612 5:124983079-124983101 CAGAAAAAGGCGTAACAGGCTGG - Intergenic
997002617 5:129780505-129780527 AAAAAAAAGTGGAAGAAGGGAGG + Intergenic
997506539 5:134422019-134422041 AAGAGAAAGGAGAAGAAGGAAGG - Intergenic
997533805 5:134600027-134600049 AAAAAAAAGAAAAAGAAGGCTGG + Intergenic
997567132 5:134896937-134896959 AAAAAAAAGGAAAAAAAGGCTGG - Intronic
997571480 5:134931196-134931218 AAAAAAAAGAAAAAGAAGGCCGG - Intronic
997963404 5:138338806-138338828 AAGAAAAACATGAGGAAGGCAGG - Intronic
998426694 5:142034906-142034928 AAGAAAAAGGCTGAGAGGCCTGG - Intergenic
998810683 5:145963191-145963213 AAAAAAAAGTGGAATAAGGCTGG - Intronic
998834382 5:146189910-146189932 AAGAATAAAGAGAAGAAGGTAGG + Intergenic
998866276 5:146506065-146506087 AAAAAAAAGGATAAAAAGGCCGG - Intronic
999292705 5:150437215-150437237 AAGAAAAGAAGGAAGAAGGCAGG + Intergenic
999809962 5:155118252-155118274 AAGAAAAAGCAGAGGAAGGAGGG + Intergenic
1000171180 5:158704609-158704631 AAGAAAAAAAGGATGAAGGCAGG - Intronic
1000209815 5:159098684-159098706 AAGAAGAAAGAAAAGAAGGCAGG + Intronic
1000499283 5:162028734-162028756 AAGAAAAATGGGAGGAAGGGAGG + Intergenic
1001185529 5:169567860-169567882 AAAAAAAAGGAGAAGAAGAGAGG - Intergenic
1002858998 6:1063151-1063173 AGGAAAACTGCAAAGAAGGCTGG + Intergenic
1002887964 6:1312590-1312612 GAGAAAAAGGCGAAGATCCCCGG + Exonic
1003228560 6:4228731-4228753 TAGAAAAATGAGTAGAAGGCTGG + Intergenic
1003509929 6:6771287-6771309 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509940 6:6771330-6771352 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509951 6:6771373-6771395 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003648143 6:7932960-7932982 AAGCAAAAAGCGAAGAAGGTTGG + Intronic
1003679714 6:8240430-8240452 AAAAAAAAGAAGAAGAAGGGAGG - Intergenic
1003759681 6:9162725-9162747 AAGAAAAAAGGAAGGAAGGCAGG + Intergenic
1003844741 6:10161304-10161326 TAGATAAAGGTAAAGAAGGCAGG + Intronic
1003957054 6:11173846-11173868 AAGAAAAAGGAAAAGAAAGAAGG - Intergenic
1004201296 6:13550340-13550362 AACAAAAAAGATAAGAAGGCTGG - Intergenic
1004945609 6:20609354-20609376 AAGGAGAAGGAGAAGAAGGGAGG - Intronic
1005478785 6:26234851-26234873 AAGAAAAAGGCGAAGAAGGCAGG - Exonic
1005492547 6:26360177-26360199 AAAAAAAAGTCCAAGAAAGCTGG - Intergenic
1005609602 6:27510977-27510999 AAAAAAAAGGAAAAGAAGCCTGG + Intergenic
1005731008 6:28696720-28696742 AAGAAAAAGTCAAAGAGGCCCGG + Intergenic
1006008613 6:31023171-31023193 AAAAAAAAGGCGAAAAATGGAGG + Intronic
1006024208 6:31137158-31137180 AAGAAAAAGAAGAAAGAGGCCGG + Intronic
1006304162 6:33208761-33208783 GAGGAGAAGGCGAAGAAGGCTGG - Exonic
1006472319 6:34235941-34235963 AAGCCAAAGGGGAAGATGGCGGG - Intergenic
1006500672 6:34457031-34457053 ATGAAAAAGGGACAGAAGGCAGG + Intergenic
1006645059 6:35510050-35510072 AAAAAAAAGAAAAAGAAGGCAGG - Intronic
1006677579 6:35775579-35775601 AAAAAAAAGCAGAAGCAGGCAGG + Intergenic
1006751316 6:36379579-36379601 AAGAAGAAAAAGAAGAAGGCCGG + Intronic
1006768518 6:36530661-36530683 AAGAAAAAAAGGAAAAAGGCCGG - Intronic
1007134499 6:39508015-39508037 AAGAAAAAAGAGAAGAGGGAGGG - Intronic
1007169914 6:39855767-39855789 AGGAAAGAGTTGAAGAAGGCTGG - Intronic
1007397471 6:41585943-41585965 AAGAAGAAGGGGAAGAAGCTGGG - Intronic
1007543585 6:42672785-42672807 AAGAAAGTGGGGAAGGAGGCAGG - Intronic
1008286223 6:49654247-49654269 AAGAAAAAGAAGAAGAAGAAAGG - Intergenic
1008419974 6:51287125-51287147 AAGAAAAAAGAGAGGAAGGAAGG + Intergenic
1008610216 6:53178544-53178566 AACAAAAAAGCAAAAAAGGCTGG + Intergenic
1008969800 6:57354234-57354256 AAGAAACAGGGAAAGAAGGAAGG - Intronic
1009158765 6:60256060-60256082 AAGAAACAGGGAAAGAAGGAAGG - Intergenic
1009415569 6:63412581-63412603 AAGAAAGAGGCAAAGAAAGAGGG + Intergenic
1010045024 6:71431783-71431805 AAGAAAAAAGAGAGGAAGGGAGG - Intergenic
1010238398 6:73594311-73594333 AAGAAAAATGCGAAGCGGCCGGG - Exonic
1010290013 6:74124604-74124626 AAGAAGAAAGAGAAAAAGGCAGG - Intergenic
1010393620 6:75365298-75365320 AAGAAAAGGGCTTAGAAGACAGG + Intronic
1010864685 6:80960314-80960336 AAGAAAAAGGCAATGAAATCTGG - Intergenic
1011105048 6:83770079-83770101 AAGAAAAGAGCAAATAAGGCTGG + Intergenic
1011203796 6:84869178-84869200 GTGACAAAGGAGAAGAAGGCAGG - Intergenic
1011443267 6:87409507-87409529 AAAAAAAAGGCTAAGCAGGCTGG - Intronic
1011553173 6:88548311-88548333 AAGAGTGAGGGGAAGAAGGCAGG + Intergenic
1011695751 6:89911273-89911295 AAGAAAGAGGAAAAGAAGGGAGG - Intergenic
1011843346 6:91529306-91529328 AAGAAAGAGGAGAGGGAGGCAGG + Intergenic
1011923307 6:92610251-92610273 AAGAAAGACGGGAAGAAGGAGGG - Intergenic
1011923317 6:92610300-92610322 AAGAAAGACGGGAAGAAGGAGGG - Intergenic
1012061041 6:94481491-94481513 AAGAAAAAGGAGAGGAAGAAAGG - Intergenic
1012250408 6:96974015-96974037 AAAAAAAAAGAGAAGAAGTCAGG - Intronic
1012463535 6:99491235-99491257 AAGAAAAGGGGGAAGAGGCCAGG + Intronic
1012596003 6:101041050-101041072 AAAAAGAAGGAGAAGAAGGCAGG - Intergenic
1012713184 6:102634369-102634391 AAGAAGAAGAAGAAGAAGGAAGG + Intergenic
1013051278 6:106537979-106538001 AAGAAAAAAGCAAAGAGGGAGGG + Intronic
1013238603 6:108222051-108222073 AACAAAAATGTAAAGAAGGCCGG - Intronic
1013269651 6:108534099-108534121 AAGAAAAAGGAAAGGAAGGAAGG + Intergenic
1013424945 6:110003160-110003182 AAGAATAAGCAGAAGAAGGAAGG + Intergenic
1013793669 6:113860376-113860398 GAGAAAAAGGCCGAGGAGGCCGG + Exonic
1013863578 6:114665683-114665705 AAAAAAAAGGCATACAAGGCTGG - Intergenic
1013949698 6:115764837-115764859 AAGAAATAGGCAAAATAGGCCGG + Intergenic
1014562608 6:122909363-122909385 AAAAAAAAAAAGAAGAAGGCAGG - Intergenic
1014744019 6:125178691-125178713 AAGAAAAAATCAATGAAGGCAGG + Intronic
1014794983 6:125714555-125714577 AAGTGAAAGGACAAGAAGGCAGG - Intergenic
1014835084 6:126151876-126151898 AAGAAAAAGACAAGGAAGGAAGG - Intergenic
1014904706 6:127012023-127012045 AAGAAAAAGGGAAATGAGGCAGG - Intergenic
1014948005 6:127519013-127519035 AAGAGGAAAGAGAAGAAGGCGGG + Exonic
1015510759 6:134036039-134036061 AAGAAAGAGAAGAAGAAAGCAGG - Intronic
1016493523 6:144633526-144633548 AACAAAATGGAGAAGCAGGCCGG - Intronic
1016532534 6:145074889-145074911 AAGAAAGAAGGGAAGAAGGGAGG + Intergenic
1016772805 6:147870784-147870806 AAGAAAAAAGGGAAGAGGGAAGG + Intergenic
1016794118 6:148099645-148099667 AAGAAGAAGAAGAAGAAGCCTGG - Intergenic
1016801476 6:148173513-148173535 AAGAAGAAGGGGAAGAAGGGGGG + Intergenic
1016814485 6:148290976-148290998 AAGATAAAGTGGAAGAATGCAGG - Intronic
1016958981 6:149653547-149653569 GAGAACAAGGAAAAGAAGGCTGG + Intergenic
1017611459 6:156190789-156190811 CAGCACAAGGTGAAGAAGGCCGG - Intergenic
1017718119 6:157225953-157225975 AAGAAAAGGACAAAGAAGGGAGG - Intergenic
1017757920 6:157545378-157545400 AAAAAAAAGGAGGAGGAGGCCGG + Intronic
1017786074 6:157758241-157758263 AAGAAAAAAGAGAGGAAGGAAGG + Intronic
1017988542 6:159466182-159466204 AAGAAGAAGAAGAAGAAGCCGGG - Intergenic
1019465964 7:1189138-1189160 AGGAAGAAGAAGAAGAAGGCGGG + Intergenic
1019494974 7:1333475-1333497 TAAAAAAAGGAGAAGAAGGAGGG - Intergenic
1019571054 7:1712414-1712436 AAAAAAAAAGGAAAGAAGGCTGG - Intronic
1019825446 7:3280437-3280459 AAGAAAAAGAGGAACATGGCCGG - Intergenic
1019938684 7:4272454-4272476 AAGAAAATGGCAAACCAGGCCGG + Intergenic
1020030805 7:4931446-4931468 AAGAAAAAGGTAAAGAGGCCAGG - Intronic
1020877718 7:13719232-13719254 ACCAAAAAGGCAAACAAGGCAGG + Intergenic
1021896878 7:25244866-25244888 AAGAAAAATGGGAAGATGCCAGG - Intergenic
1022001850 7:26233494-26233516 AAGAAGAAGAAGAAGAAGGCTGG + Intergenic
1022243610 7:28535663-28535685 AAGAGAAAGGGCAAGAAGGAAGG + Intronic
1022280721 7:28906644-28906666 AATAAAAAAGTGAAGAGGGCCGG + Intergenic
1022481005 7:30743032-30743054 AAGAAAGAGGCGCAGGAGGAGGG - Intronic
1022642896 7:32204999-32205021 AAGAAAAAAGGGAAGAAGAGAGG + Intronic
1022764045 7:33390093-33390115 AAGGAAAAGGAAAAGAAGGAAGG - Intronic
1023260382 7:38352980-38353002 AAGAGAAAAGCAAAGAAGGAAGG + Intergenic
1023261354 7:38362129-38362151 AAGAGAAAAGCAAAGAAGGAAGG + Intergenic
1023357386 7:39381036-39381058 ACAAAAAAGGCTGAGAAGGCTGG - Intronic
1023556624 7:41430118-41430140 GAGAAACAGGAGAGGAAGGCTGG - Intergenic
1023565693 7:41521966-41521988 AAGAAGAAGAAGAAGAAGGAAGG + Intergenic
1023808663 7:43893572-43893594 AAGTAAAAGGACAAAAAGGCTGG + Intronic
1023922601 7:44641195-44641217 AAAAAAAAGAAGAAAAAGGCTGG - Intronic
1023934192 7:44727526-44727548 AAGTAATAGGAGATGAAGGCAGG + Intergenic
1024108041 7:46113405-46113427 AAGAAAGAGGAGAAAAAGACAGG - Intergenic
1024731129 7:52254978-52255000 AAGAAAAAGGAGAAGAAAGAGGG + Intergenic
1024791148 7:52966114-52966136 AAGAAAAAAGGAAAGAAGGAAGG - Intergenic
1024807171 7:53156397-53156419 AAGACAAATGAGAAGAGGGCGGG - Intergenic
1024827976 7:53414974-53414996 AAGAAAAAGATGAATCAGGCCGG - Intergenic
1024919304 7:54541706-54541728 AAGATGAAGGAAAAGAAGGCAGG + Intergenic
1025064624 7:55842614-55842636 AAAAAAAAGAAAAAGAAGGCTGG + Intronic
1025145142 7:56495434-56495456 AAGACAAAGGCCAAGAACCCAGG - Intergenic
1025319516 7:58079792-58079814 AAGACAAATGAGAAGAGGGCAGG + Intergenic
1025489153 7:61090255-61090277 AAGACAAATGAGAAGAGGGCAGG - Intergenic
1025554199 7:62283679-62283701 AAGACAAATGAGAAGAGGGCAGG - Intergenic
1025560582 7:62369595-62369617 AAGACAAATGAGAAGAGGGCAGG + Intergenic
1025562304 7:62382692-62382714 AAGAAAAATGGGAAGCAGGTAGG - Intergenic
1025607550 7:63050288-63050310 AAGAAGAAGAAGAAGAAGGAAGG + Intergenic
1025744401 7:64230236-64230258 AAGAAAAGGGCCAAGAGGCCGGG + Intronic
1025840692 7:65143108-65143130 AAGAAAAATGGCAAGCAGGCAGG - Intergenic
1025878019 7:65507055-65507077 AAGAAAAATGGCAAGCAGGCAGG + Intergenic
1025882356 7:65552849-65552871 AAGAAAAATGGCAAGCAGGCAGG + Intergenic
1025891086 7:65649753-65649775 AAGAAAAATGGCAAGCAGGCAGG - Intergenic
1026027996 7:66762616-66762638 AAGAAATAGGACATGAAGGCTGG + Intronic
1026168443 7:67931904-67931926 AAGAAAAAGCCTTAGAAGCCCGG + Intergenic
1026258585 7:68734420-68734442 AAGAAGTAGGACAAGAAGGCCGG - Intergenic
1026509170 7:71013754-71013776 AAGAGAAAAGGGAAGAAGGAAGG + Intergenic
1026645195 7:72161379-72161401 AAGAATAAGGTGGAGAAGGATGG + Intronic
1026769195 7:73183509-73183531 AAGAAAAATGCACTGAAGGCCGG + Intergenic
1026851205 7:73724559-73724581 AAAAAAAAGAAGAAAAAGGCCGG - Intergenic
1027010064 7:74736894-74736916 AAGAAAAATGCACTGAAGGCCGG + Intronic
1027077977 7:75209143-75209165 AAGAAAAATGCACTGAAGGCCGG - Intergenic
1027111444 7:75442872-75442894 CAGAAACAGGCGTTGAAGGCAGG - Intronic
1027234206 7:76288135-76288157 AAGAAAAAGGAAAGGAAGGAAGG + Intergenic
1027283673 7:76627405-76627427 CAGAAACAGGCGTTGAAGGCAGG - Intergenic
1027352276 7:77324362-77324384 AAGCAAAAGGTGGGGAAGGCTGG - Intronic
1027533533 7:79366386-79366408 AAGACAAAGGGAAAGAGGGCAGG + Intronic
1027882216 7:83855132-83855154 AAGAAGAAGGAGAAAGAGGCAGG + Intergenic
1027900657 7:84110130-84110152 ATGGAAAAGGAGGAGAAGGCTGG + Intronic
1027902619 7:84136915-84136937 AAGAAGAAGGGGAGGAAGGAAGG + Intronic
1028450921 7:90982304-90982326 AGTAAATAGGCGAAGAAGGAGGG + Intronic
1028493486 7:91439963-91439985 AAGAAAAAGGGAAGGAAGGGAGG + Intergenic
1028509052 7:91601830-91601852 TAGAAAAAGACAAAGAAGGCTGG - Intergenic
1028639344 7:93025939-93025961 GAAAAAAAGGAGAAGAAGGGTGG + Intergenic
1028742311 7:94289673-94289695 AATAAAAAGGAGAAGAAGATAGG + Intergenic
1028792297 7:94866724-94866746 AAGGCAAAGGGGAAGCAGGCAGG - Intergenic
1028877425 7:95839325-95839347 AAGAAAAAGAGAAAGGAGGCTGG - Intronic
1029065430 7:97843559-97843581 AAGACAAAGGAAAAGCAGGCAGG + Intergenic
1029269493 7:99368492-99368514 AAAAAAAAGGCAAAATAGGCCGG - Intronic
1029321157 7:99761475-99761497 AAGAAGAAGGAGGAGAAGGAGGG - Intronic
1029330592 7:99850537-99850559 ATAAAAAAGGTGAGGAAGGCAGG - Intronic
1029330998 7:99855289-99855311 TAGATAAAGGCTAAGAAGTCAGG + Intronic
1029462121 7:100701295-100701317 AAGAAAAAGGGAAGGAAGGAAGG - Intergenic
1029539752 7:101175629-101175651 AAAAAAAAGAAGAAGAAGGCTGG + Intronic
1029554002 7:101255060-101255082 AAGAAGAAGGAGAAGCTGGCTGG + Intergenic
1029557693 7:101281757-101281779 AAGAAAAAAGGAAAGAAGGAAGG + Intergenic
1029646315 7:101858429-101858451 AAGAAAAAGTCAGGGAAGGCGGG - Intronic
1030275283 7:107714306-107714328 TAGAAAAAGGCAGAGAAGGCAGG - Intronic
1030344340 7:108415583-108415605 CATAAAAAGGAGAAGAAGGCCGG + Intronic
1030605118 7:111632529-111632551 AAGAAAAAAGAAAAGAAGGAAGG - Intergenic
1030676953 7:112394201-112394223 AAGAAAGAAGGGAAGCAGGCAGG - Intergenic
1030900713 7:115120176-115120198 AAAAAAAAGAAGAAGAAGCCAGG + Intergenic
1031245965 7:119311516-119311538 AAAAAAAAGAAGAAGAAGACTGG + Intergenic
1031432047 7:121683889-121683911 AAGGAAAATGCGAAGAAAACAGG - Intergenic
1031707241 7:124996456-124996478 AAAAAAAAGGCTAAAAAGTCCGG + Intergenic
1031895193 7:127340194-127340216 AAGAAAAAGGGAAGGAAGGAAGG - Intergenic
1032131814 7:129235403-129235425 AAGAAGAATGAGAAGGAGGCTGG - Intronic
1032277516 7:130472297-130472319 AAGAAAAAGGGAAGGAAGGAAGG - Intergenic
1032628315 7:133618154-133618176 AAGAAAAAGGTATAAAAGGCAGG - Intronic
1032670059 7:134074312-134074334 AAGAAAGGGGAGAAGAAGGGAGG - Intergenic
1033005138 7:137552919-137552941 AAAAAAAAGGAAAAGAAAGCTGG + Intronic
1033173515 7:139104739-139104761 AAAAAAAAGTCAAACAAGGCCGG + Intronic
1033190938 7:139278473-139278495 AAAAAAAGGGAGAAGGAGGCTGG - Intronic
1033519354 7:142145373-142145395 AAGGAAAAAGGGAAGAAGGAAGG - Intronic
1034287694 7:149899687-149899709 AAGGAAAAGAGAAAGAAGGCAGG + Intergenic
1034663434 7:152793234-152793256 AAGGAAAAGAGAAAGAAGGCAGG - Intronic
1034975483 7:155446868-155446890 AAGGAAAAGGGGAAGGAGGGAGG + Intergenic
1034978901 7:155463399-155463421 AGGAAAAAGGAGAAGGAGGAGGG - Exonic
1034978914 7:155463451-155463473 AAGAAAAAGAAGAAGAAAGGAGG - Exonic
1035575900 8:704764-704786 AAGAAAAAGAAGAAGAAAACAGG + Intronic
1036010905 8:4721977-4721999 AAGAAACAGGAGAAGAACGATGG + Intronic
1036254379 8:7193411-7193433 AAGAAAAATGCTAAGAATACAGG + Intergenic
1036363116 8:8094077-8094099 AAGAAAAATGCTAAGAATACAGG - Intergenic
1036408534 8:8477494-8477516 TCTAAAAAGGAGAAGAAGGCAGG + Intergenic
1036552889 8:9830726-9830748 AAGAAAGATGGGAAGAAGGGAGG - Intergenic
1036685522 8:10907057-10907079 AAGAAAAAGAAGAAGAAGAAGGG + Intronic
1036895445 8:12631103-12631125 AAGAAAAATGCTAAGAATACAGG + Intergenic
1037473279 8:19231832-19231854 AAGAAATATAAGAAGAAGGCAGG - Intergenic
1037901189 8:22690537-22690559 GAGAAGAAGGCGGAGAAGGGCGG - Exonic
1037999752 8:23381636-23381658 TAGAAAAAGGGGTATAAGGCAGG - Intronic
1038077038 8:24087919-24087941 AAAAAAAAGGAGAGGAAGGTGGG - Intergenic
1038779742 8:30559751-30559773 AAGAAAAATGAGAAGAGGGAGGG + Intronic
1038792273 8:30678686-30678708 AAGAAAAAAGAAAATAAGGCAGG + Exonic
1039157818 8:34581589-34581611 AAGAAAAAGGAAAAGAAAGAAGG + Intergenic
1039213036 8:35236830-35236852 AGGAAAAAGGGAAAGAAGGGCGG - Intronic
1039400332 8:37263654-37263676 AAGGAAAAGGGGAAGCAGGCAGG + Intergenic
1039662540 8:39482872-39482894 AACAAAAAGGGGAAAAAGGGAGG - Intergenic
1039793930 8:40896601-40896623 AAGCCAAAGGCGGAGGAGGCAGG + Intronic
1039977590 8:42380515-42380537 AAGAAAAAAGAGAGGAAGGAAGG + Intergenic
1040330698 8:46384321-46384343 AAGAAAACGGAGAAGCAGGGTGG + Intergenic
1040365274 8:46709008-46709030 AAGACAAAGGAAAAGCAGGCAGG - Intergenic
1041145346 8:54870246-54870268 AAGAAAAAGGAAAAGAAAGAAGG - Intergenic
1041552119 8:59114722-59114744 AAGAAAAAGGAAAAGATGGGAGG - Intronic
1042082947 8:65075923-65075945 AAGATGAAGGGGAAGAAAGCAGG + Intergenic
1042176539 8:66042727-66042749 AAGAAGAAGACGAAGAAGAGGGG - Intronic
1042339541 8:67664595-67664617 AAGAAAAAGAAAAAAAAGGCAGG - Intronic
1042363898 8:67914542-67914564 AAAAAGAAGGGGAGGAAGGCTGG - Intergenic
1043284646 8:78514343-78514365 AAGGCAAAGGGGAAGCAGGCAGG - Intergenic
1044168453 8:89018642-89018664 AAGAAAGAAGGGAAGAAGGAAGG - Intergenic
1044469822 8:92553777-92553799 AAGGAATAGGGGAAGAAGTCTGG - Intergenic
1044706174 8:95010866-95010888 AAGACAAAGGGGAAGGAAGCAGG + Intronic
1044785282 8:95786857-95786879 AAGGAAAAGAGAAAGAAGGCAGG + Intergenic
1045333865 8:101180733-101180755 AAGATAAAGGGGAAGACAGCAGG - Intronic
1045865468 8:106860517-106860539 AATAAAAAAGAGAAGGAGGCCGG + Intergenic
1046015600 8:108601126-108601148 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1046160127 8:110351563-110351585 AAAAAAAAAAAGAAGAAGGCAGG - Intergenic
1046389051 8:113543785-113543807 AACAAAAAGGCAGAGAAGGGCGG - Intergenic
1046934964 8:119876643-119876665 AAAAAAAAGAAGAAGAAGGATGG + Intronic
1046971085 8:120224009-120224031 AAAAAAAAGGAGATGAGGGCAGG - Intronic
1047127082 8:121974513-121974535 AGGAAAAAGAAGAAGAAGGAAGG - Intergenic
1047265386 8:123302824-123302846 AAGAAAAAGAAGAACAAAGCAGG - Intergenic
1047484110 8:125313107-125313129 AAAAAAAAGGGAAAGAAGGAAGG + Intronic
1047568487 8:126072785-126072807 AAGAAAAAGGAGAAAAAGAAGGG + Intergenic
1047728867 8:127709199-127709221 AAGAATGAGGCCAAGGAGGCCGG - Intergenic
1048066734 8:130977407-130977429 AGGAAAAAAGCAAAGAAGGTTGG - Intronic
1048073828 8:131047072-131047094 AAGGAAAAACAGAAGAAGGCAGG - Intergenic
1048403759 8:134097269-134097291 AAGAAAAAGGAGAAATAGGGAGG + Intergenic
1048413802 8:134203866-134203888 AATAAAAAGTGGAAGGAGGCTGG - Intergenic
1048430863 8:134369282-134369304 AAGAAGAAGAAGAAGAAGGGAGG - Intergenic
1048912592 8:139150351-139150373 AAGAAAAATGGGAAGGAGACTGG - Intergenic
1050353719 9:4763539-4763561 AGGAAAAAGGGGGAGGAGGCAGG + Intergenic
1050364528 9:4862037-4862059 AAGAAAAATGGGAAGAAAACAGG - Intronic
1050475918 9:6040989-6041011 AAGGAAAAGAGGAAGAAGGAAGG - Intergenic
1050548465 9:6728907-6728929 ATGAAAAAAAGGAAGAAGGCTGG + Intronic
1050602040 9:7262596-7262618 CAGAAAAAAGGGAAGTAGGCAGG + Intergenic
1050769444 9:9178363-9178385 AAGAAAAAAGGAAAGAAGGAAGG - Intronic
1051187901 9:14479974-14479996 AGGAAGAAGGAGAAGGAGGCAGG + Intergenic
1051328274 9:15997083-15997105 AAGATAAAGGGGAAGAAAGGAGG + Intronic
1051546737 9:18283932-18283954 AAGAAGAAGAAGAAGAAGGCTGG + Intergenic
1052052082 9:23860082-23860104 AACCAAAAGGAGAAAAAGGCAGG - Intergenic
1052191199 9:25664637-25664659 AACAAATAGTTGAAGAAGGCTGG - Intergenic
1052846951 9:33345178-33345200 AAGAAAAAGAAAAAAAAGGCCGG + Intronic
1052869973 9:33495150-33495172 AAAAAAAAGGAAAAGAAGGGAGG + Intergenic
1052946421 9:34172004-34172026 AAAAAAAAGGAGAAGAAGAAGGG - Intergenic
1052951017 9:34211697-34211719 AAGGAAAAGTTGAAGGAGGCAGG - Intronic
1053037827 9:34840535-34840557 AAGAAGAAGAAGAAGAAGGAAGG - Intergenic
1053231023 9:36409343-36409365 AAGAAAAAAAGAAAGAAGGCAGG + Intronic
1053486893 9:38465354-38465376 AAGAAAAAGAAAAAGAAGGAAGG + Intergenic
1054856273 9:69902801-69902823 ATGAAATAGGAGAACAAGGCAGG - Intronic
1055212762 9:73817170-73817192 AGGAAAAAGGAGAAAAAGGCGGG + Intergenic
1055405044 9:75965526-75965548 AACAAAAAGCAGAAGAAGGGAGG - Intronic
1055706337 9:79008908-79008930 AAGAAGAAAGGAAAGAAGGCAGG + Intergenic
1055822078 9:80277919-80277941 AAGAAAAAGGGTAAGAGGGAAGG - Intergenic
1056486730 9:87066239-87066261 AACAGAAAGGGGAAGAAGTCTGG + Intergenic
1056645642 9:88409289-88409311 AAGAAAAAAGAAAAGCAGGCCGG - Intronic
1056670673 9:88625325-88625347 AAAAGAGAGGGGAAGAAGGCTGG - Intergenic
1057132787 9:92666344-92666366 AAGCTGAAGGCGAAGGAGGCAGG + Intronic
1057266233 9:93619817-93619839 AACAAAAAGGCAAAGTTGGCCGG - Intronic
1057279665 9:93700598-93700620 AAAACAAAAGGGAAGAAGGCTGG - Intergenic
1057292882 9:93818465-93818487 AAGAAAAAAGGAAAGAAGGAAGG + Intergenic
1057813884 9:98279752-98279774 AAGAAAAAAGGGAAGAAAGTGGG - Intergenic
1057972051 9:99567830-99567852 TTTAAAAAGGGGAAGAAGGCTGG + Intergenic
1058296441 9:103314006-103314028 AATAGAAATGTGAAGAAGGCAGG + Intergenic
1058635586 9:107035311-107035333 AAGAAGGAGGCTTAGAAGGCAGG - Intergenic
1058690081 9:107512585-107512607 AAGAAAAAAGGAAAAAAGGCTGG + Intergenic
1058704824 9:107629526-107629548 AAGAAAAAGGGGAGGAAGAATGG - Intergenic
1058825494 9:108772675-108772697 AAGAGACAAGCGAAGAAGGGAGG + Intergenic
1058832884 9:108835066-108835088 AATAGAAAGGAGAATAAGGCAGG - Intergenic
1059483421 9:114609717-114609739 AAGAAAAAGAAAAAGAAGGAAGG + Intergenic
1059799485 9:117735881-117735903 AAAAAGAAGAAGAAGAAGGCTGG + Intergenic
1059926988 9:119219483-119219505 AAGATAAATGGGAAGAAGGAAGG - Intronic
1060537000 9:124398244-124398266 AAGGAAAGGGTAAAGAAGGCAGG + Intronic
1060649220 9:125310832-125310854 AAAAAAAAAAAGAAGAAGGCTGG - Intronic
1060769810 9:126324555-126324577 AAGAAGAAGAAGAAGAAGGAAGG + Intergenic
1060871001 9:127040102-127040124 AAGAAAAGGCTGAAGTAGGCCGG + Intronic
1061347268 9:130036747-130036769 AAGAAAAAGGAGCAGTAGGCCGG + Intronic
1061585404 9:131564195-131564217 AAGAAATAGGCAAACAGGGCTGG - Intergenic
1061828767 9:133277385-133277407 AAGAAAAGGGGAAAGAAGGGAGG + Intergenic
1061979031 9:134089314-134089336 AAGAAGAAGGGAAAGATGGCTGG + Intergenic
1062704304 9:137927231-137927253 AAAAAAAAGAAGAAGAAAGCTGG - Intronic
1203751319 Un_GL000218v1:83401-83423 AAGAAAAAGGCAGAGAAAGTTGG + Intergenic
1203753005 Un_GL000218v1:97438-97460 AGGAAAATGGCGAAGTGGGCGGG + Intergenic
1203710004 Un_KI270742v1:89421-89443 AAGAAAAAGGCAGGGAAAGCTGG + Intergenic
1185507634 X:642333-642355 AATAAAACGGTGAAGAAGGGAGG - Intronic
1185510425 X:660049-660071 AAGAAGAAGAAGAAGAAGGCTGG - Intergenic
1185538357 X:882046-882068 AAAAAAAAGGAGAGGAAGGCTGG - Intergenic
1185611093 X:1394136-1394158 AAGAAAAAAGAAAAGGAGGCGGG - Intergenic
1185611105 X:1394206-1394228 AAGAAAAAGGAAAAGGAGGGAGG - Intergenic
1185700430 X:2227347-2227369 AAGAAAAAGAGGAAGAAGAAAGG + Intronic
1186519154 X:10189959-10189981 AAGAAGAAGGTGAAGAAGATGGG - Intronic
1186671580 X:11772271-11772293 ATGAAAAATGGAAAGAAGGCAGG - Intronic
1186908748 X:14139049-14139071 AAGGAGAAGGGGGAGAAGGCAGG + Intergenic
1187025797 X:15434169-15434191 AAGAAGAAGGAGGAGAAGGAAGG + Intronic
1187072872 X:15905660-15905682 CAGATAAAGGAGAAAAAGGCTGG - Intergenic
1187109461 X:16281725-16281747 AAGAAAAAGGGATAGAAGGAAGG - Intergenic
1187264560 X:17719020-17719042 AAGAAAAAAGGAAAGAAGGAGGG + Intronic
1187272671 X:17792934-17792956 AATAAAAAGGCAAAGAAGGAAGG + Intergenic
1187308589 X:18119548-18119570 AAAAAAAAGGAAAAGACGGCAGG + Intergenic
1187418102 X:19110979-19111001 AAGAAAGAGACGGAGAAGGATGG + Intronic
1187495539 X:19792602-19792624 TAGAGAAAGGGGAAGAAGACAGG + Intronic
1187529713 X:20085252-20085274 AGGAAAGAGGAGAAGAAGGATGG + Intronic
1187695244 X:21913000-21913022 AAGAAATTGGAGAAGATGGCCGG - Intergenic
1188004052 X:25005352-25005374 AAAAAAAAGACGGAGAAGGTGGG + Intronic
1188325180 X:28793350-28793372 AACAAAAAGGGAAAGAAGGGAGG - Intronic
1188555205 X:31404030-31404052 AGGAAAGAAGTGAAGAAGGCTGG - Intronic
1189425575 X:40897125-40897147 AAGAAAAAGAAAAAGAAGACTGG + Intergenic
1189447985 X:41098839-41098861 ATGAAAAAGACGAAGTTGGCTGG - Intronic
1189805108 X:44727709-44727731 AAGAAGAAGAAGAAGAAGGCCGG + Intergenic
1190477114 X:50839508-50839530 AAGGAAAAGGCCAAGAATACAGG - Intergenic
1190549996 X:51570276-51570298 AAGAAAAAGGGGAAGGGGCCAGG - Intergenic
1192130219 X:68542879-68542901 AAAAAGAAGAAGAAGAAGGCTGG - Intergenic
1192444285 X:71198948-71198970 TTGAAAAAGGCGAAGCTGGCTGG - Intergenic
1192497341 X:71624782-71624804 ATCAAAAAGGAGAATAAGGCCGG + Intergenic
1192497387 X:71625102-71625124 AAAAAAAAGGAGAATAAGCCAGG + Intergenic
1192833826 X:74778428-74778450 AAGAAAAAAGAAAAGAAGGAAGG - Intronic
1193285090 X:79703774-79703796 CAGAAAAAGGCCAAGAAGTTAGG + Intergenic
1193336205 X:80292656-80292678 AAGAAAAAGCCCAAGAAAGATGG - Intergenic
1193810811 X:86048499-86048521 AAGCAAAAGGGGAAGGATGCTGG + Intergenic
1193940556 X:87676753-87676775 AGGAAAAAGGAGAAAAAGGGGGG + Intergenic
1194996418 X:100596025-100596047 AAGATTAAGGCAAAGGAGGCGGG + Intronic
1195512691 X:105735667-105735689 AAGAATAAGGCAAAGCAGGGTGG - Intronic
1196296585 X:114004451-114004473 AAGAGAAAGGGGGATAAGGCAGG - Intergenic
1196769799 X:119282107-119282129 AAGAAAATGGAGAGGGAGGCCGG - Intergenic
1196852910 X:119955736-119955758 AAGAAAAAGAAAAAGAAAGCCGG - Intergenic
1196938296 X:120751203-120751225 AGGAAAAAGGAGAAGAGGGAGGG - Intergenic
1197257861 X:124283384-124283406 AAAAAAAGGGCAAAGGAGGCCGG - Intronic
1197773098 X:130102515-130102537 AAGAAAAAGAAAAAAAAGGCTGG + Intronic
1197930415 X:131689296-131689318 AAGGCAAAGGGGAAGCAGGCAGG + Intergenic
1197961979 X:132017031-132017053 AAAAAAAAGAAGAAGAAGGGAGG + Intergenic
1197980702 X:132216434-132216456 AAGTAAAATGCCTAGAAGGCAGG + Intronic
1198560211 X:137841604-137841626 AAGAAAAAGGTGAATAACACTGG - Intergenic
1198706172 X:139450819-139450841 AAGAAAAAGGAGGAGAGGGAAGG + Intergenic
1198985136 X:142442576-142442598 AAAAAAAAAAGGAAGAAGGCAGG - Intergenic
1199038812 X:143085757-143085779 AAGAAGAAAGGGAAGAAGGAAGG + Intergenic
1199702918 X:150398387-150398409 AAGAAGAAGAAGAAGAAGACAGG + Intronic
1200163940 X:154023368-154023390 AAGTAAAGGGCAAAGAAGGAAGG + Intronic
1200243837 X:154512276-154512298 AAGAAGAAGAAGAAGAAGCCGGG + Intronic
1200415621 Y:2906915-2906937 AAAAATAAGGAGAAGGAGGCTGG - Intronic
1201164978 Y:11201014-11201036 AAGAAAAAGGCAGAGAAAGTTGG + Intergenic
1201166647 Y:11215008-11215030 AGGAAAATGGCGAAGTGGGCGGG + Intergenic
1201298448 Y:12485767-12485789 AAGAATAAGGTGAGGAAGGAGGG - Intergenic
1201461675 Y:14232565-14232587 AAGAAGAAGCAGAAGAAGGAAGG - Intergenic
1201705336 Y:16930315-16930337 AAGAAAAAGAAAAAGAAAGCAGG + Intergenic