ID: 1005479316

View in Genome Browser
Species Human (GRCh38)
Location 6:26240523-26240545
Sequence TCGGGCCAAGCGACGGATGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 34
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 31}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005479316_1005479325 17 Left 1005479316 6:26240523-26240545 CCGCCATCCGTCGCTTGGCCCGA 0: 1
1: 0
2: 0
3: 2
4: 31
Right 1005479325 6:26240563-26240585 CATTTCGGGCCTCATTTATGAGG 0: 1
1: 0
2: 4
3: 5
4: 104
1005479316_1005479324 3 Left 1005479316 6:26240523-26240545 CCGCCATCCGTCGCTTGGCCCGA 0: 1
1: 0
2: 0
3: 2
4: 31
Right 1005479324 6:26240549-26240571 GGCGGCGTGAAACGCATTTCGGG 0: 1
1: 1
2: 2
3: 3
4: 22
1005479316_1005479323 2 Left 1005479316 6:26240523-26240545 CCGCCATCCGTCGCTTGGCCCGA 0: 1
1: 0
2: 0
3: 2
4: 31
Right 1005479323 6:26240548-26240570 CGGCGGCGTGAAACGCATTTCGG 0: 1
1: 0
2: 0
3: 0
4: 17
1005479316_1005479327 27 Left 1005479316 6:26240523-26240545 CCGCCATCCGTCGCTTGGCCCGA 0: 1
1: 0
2: 0
3: 2
4: 31
Right 1005479327 6:26240573-26240595 CTCATTTATGAGGAGACCCGCGG 0: 1
1: 3
2: 2
3: 12
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005479316 Original CRISPR TCGGGCCAAGCGACGGATGG CGG (reversed) Exonic