ID: 1005479316

View in Genome Browser
Species Human (GRCh38)
Location 6:26240523-26240545
Sequence TCGGGCCAAGCGACGGATGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 34
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 31}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005479316_1005479327 27 Left 1005479316 6:26240523-26240545 CCGCCATCCGTCGCTTGGCCCGA 0: 1
1: 0
2: 0
3: 2
4: 31
Right 1005479327 6:26240573-26240595 CTCATTTATGAGGAGACCCGCGG 0: 1
1: 3
2: 2
3: 12
4: 67
1005479316_1005479323 2 Left 1005479316 6:26240523-26240545 CCGCCATCCGTCGCTTGGCCCGA 0: 1
1: 0
2: 0
3: 2
4: 31
Right 1005479323 6:26240548-26240570 CGGCGGCGTGAAACGCATTTCGG 0: 1
1: 0
2: 0
3: 0
4: 17
1005479316_1005479324 3 Left 1005479316 6:26240523-26240545 CCGCCATCCGTCGCTTGGCCCGA 0: 1
1: 0
2: 0
3: 2
4: 31
Right 1005479324 6:26240549-26240571 GGCGGCGTGAAACGCATTTCGGG 0: 1
1: 1
2: 2
3: 3
4: 22
1005479316_1005479325 17 Left 1005479316 6:26240523-26240545 CCGCCATCCGTCGCTTGGCCCGA 0: 1
1: 0
2: 0
3: 2
4: 31
Right 1005479325 6:26240563-26240585 CATTTCGGGCCTCATTTATGAGG 0: 1
1: 0
2: 4
3: 5
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005479316 Original CRISPR TCGGGCCAAGCGACGGATGG CGG (reversed) Exonic
900145838 1:1158341-1158363 TCGGGCCCAGCCAGGGCTGGGGG + Intergenic
900564751 1:3326778-3326800 TCAGGCCACGCGGCGGCTGGTGG - Intronic
902365331 1:15969470-15969492 GCGGGCCATGCCACGGCTGGTGG + Intronic
1074664075 10:115697895-115697917 TCGAGCCAAGCCAATGATGGAGG + Intronic
1077411739 11:2406897-2406919 TGGGGCCCAGCCAGGGATGGAGG + Intronic
1083923972 11:65794928-65794950 TAGGGCCAAGGGATGGACGGAGG - Intronic
1094039671 12:26109774-26109796 GCAGGCCAAGCGAAGGCTGGAGG + Intergenic
1122945528 14:105006902-105006924 TCGGGCCAACCCAGGGATGGGGG + Intronic
1127315464 15:57790393-57790415 TCGGGACAAGCTACAGAGGGAGG - Intergenic
1129313391 15:74726983-74727005 CCTGGACCAGCGACGGATGGTGG - Intergenic
1131110572 15:89761996-89762018 TCAGGCCAAGCGCTGGATCGTGG - Intronic
1142127869 16:88419209-88419231 CCGTGCCAAGCCACGGAAGGGGG + Intergenic
1148858240 17:50590797-50590819 TGGGGCCAAGAGAGAGATGGAGG - Intronic
1152001696 17:77649931-77649953 TTTGGCCAAACGACGGATGAAGG + Intergenic
1160797990 19:954587-954609 TGGGGCCATGCGAGGGCTGGGGG + Intronic
934677929 2:96262964-96262986 TCGGGCCAGGCCAGGCATGGAGG - Intronic
934948638 2:98560776-98560798 TAGGGCCAAGAGAGGGCTGGTGG + Intronic
942908799 2:181216290-181216312 TAGGGCCAAGCCAGGCATGGTGG - Intergenic
948884339 2:240875380-240875402 TCGGGCCAGTCGAGGAATGGGGG - Intronic
1174506333 20:51020072-51020094 TGGGGGCAAGGGAGGGATGGAGG - Intronic
1181027896 22:20136123-20136145 TCCAGCCAAGCTACGGGTGGAGG - Intronic
959495287 3:107043164-107043186 TAGGGCCAAGTGGAGGATGGAGG + Intergenic
985102767 4:186474789-186474811 TCTGGCCAAGGGACCGAGGGAGG - Intronic
996818737 5:127602157-127602179 ATGAGCCAAGCAACGGATGGAGG - Intergenic
1005479316 6:26240523-26240545 TCGGGCCAAGCGACGGATGGCGG - Exonic
1005649464 6:27873391-27873413 CCGTGCCAGGCGTCGGATGGCGG + Exonic
1013472379 6:110476716-110476738 AGGGGCCAAGCGACGGAGGGAGG - Intergenic
1026765253 7:73155736-73155758 CCGGCCCAACCGAGGGATGGGGG - Intergenic
1027041727 7:74965492-74965514 CCGGCCCAACCGAGGGATGGGGG - Intronic
1027081915 7:75236877-75236899 CCGGCCCAACCGAGGGATGGGGG + Intergenic
1029390501 7:100271422-100271444 CCGGCCCAACCGAGGGATGGGGG + Intronic
1039518317 8:38151143-38151165 CAGGGCCAGGCGAGGGATGGAGG + Exonic
1049748830 8:144274100-144274122 TCGGGCCAAGCTCCTGCTGGTGG - Intronic
1051605028 9:18909992-18910014 TCAGGCCACGCGAGGGAAGGAGG - Exonic