ID: 1005479324

View in Genome Browser
Species Human (GRCh38)
Location 6:26240549-26240571
Sequence GGCGGCGTGAAACGCATTTC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 29
Summary {0: 1, 1: 1, 2: 2, 3: 3, 4: 22}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005479319_1005479324 -4 Left 1005479319 6:26240530-26240552 CCGTCGCTTGGCCCGACGCGGCG 0: 1
1: 0
2: 0
3: 1
4: 41
Right 1005479324 6:26240549-26240571 GGCGGCGTGAAACGCATTTCGGG 0: 1
1: 1
2: 2
3: 3
4: 22
1005479316_1005479324 3 Left 1005479316 6:26240523-26240545 CCGCCATCCGTCGCTTGGCCCGA 0: 1
1: 0
2: 0
3: 2
4: 31
Right 1005479324 6:26240549-26240571 GGCGGCGTGAAACGCATTTCGGG 0: 1
1: 1
2: 2
3: 3
4: 22
1005479315_1005479324 4 Left 1005479315 6:26240522-26240544 CCCGCCATCCGTCGCTTGGCCCG 0: 1
1: 0
2: 1
3: 6
4: 53
Right 1005479324 6:26240549-26240571 GGCGGCGTGAAACGCATTTCGGG 0: 1
1: 1
2: 2
3: 3
4: 22
1005479317_1005479324 0 Left 1005479317 6:26240526-26240548 CCATCCGTCGCTTGGCCCGACGC 0: 1
1: 0
2: 0
3: 1
4: 19
Right 1005479324 6:26240549-26240571 GGCGGCGTGAAACGCATTTCGGG 0: 1
1: 1
2: 2
3: 3
4: 22

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005479324 Original CRISPR GGCGGCGTGAAACGCATTTC GGG Exonic
903766503 1:25738324-25738346 GGCGGCATAAAACCCATTTACGG - Intronic
905491927 1:38351111-38351133 GGCGGGGAGAAGAGCATTTCAGG - Intergenic
911476804 1:98383135-98383157 GGAGGAGTAAAACACATTTCTGG - Intergenic
914665971 1:149832808-149832830 GGCGGCGTTAAGCGGATCTCTGG + Intergenic
914669794 1:149860986-149861008 GGCGGCGTTAAGCGGATCTCTGG - Exonic
1078355990 11:10631725-10631747 AGCTGAGTGAAACTCATTTCTGG - Intronic
1093077269 12:14770939-14770961 GGGGGCGTCAAGCGCATTTCTGG - Exonic
1113707134 13:112442220-112442242 GGCGGGATGAAAAGCATTTGAGG + Intergenic
1129270810 15:74418359-74418381 GGCTGTGTGGAAAGCATTTCAGG - Intronic
1165351132 19:35276629-35276651 GGTGGCCTGAAAACCATTTCAGG - Intronic
1172837665 20:37883400-37883422 GGAGGCGTGGAAGTCATTTCAGG + Intergenic
1174331689 20:49824874-49824896 GGCAGTGTGAAACCCAGTTCTGG + Intronic
1179550932 21:42143325-42143347 GGAGGCCAGAAACGCATCTCTGG + Intronic
964389312 3:156181315-156181337 AGCAGCGTGAAATGCATTTGGGG + Intronic
1000624925 5:163527958-163527980 GGCCCAGTGAAACCCATTTCAGG + Intergenic
1005456189 6:26021802-26021824 GGCGGTGTGAAGCGGATCTCTGG + Exonic
1005464977 6:26104071-26104093 GGTGGCGTCAAGCGCATTTCCGG + Exonic
1005473922 6:26188931-26188953 GGCGGCGTCAAGCGTATTTCTGG - Exonic
1005475619 6:26204768-26204790 GGGGGTGTCAAGCGCATTTCTGG + Exonic
1005479324 6:26240549-26240571 GGCGGCGTGAAACGCATTTCGGG + Exonic
1005484324 6:26285354-26285376 GGCGGTGTCAAGCGAATTTCTGG - Exonic
1005570361 6:27139432-27139454 GGCGGCGTGAAGCGCATTTCTGG + Exonic
1005643994 6:27824248-27824270 GGCGGCGTGAAGCGCATCTCCGG + Exonic
1005645203 6:27831382-27831404 GGCGGCGTGAAGCGCATCTCCGG - Exonic
1005649457 6:27873365-27873387 GGAGGCGTTAAGCGCATCTCAGG - Exonic
1017940478 6:159048463-159048485 GATGGCGTGAATGGCATTTCAGG - Intergenic
1018182851 6:161239439-161239461 GGCGGAGTTAATCCCATTTCAGG - Intronic
1187281365 X:17860760-17860782 GGCGGCCCGAAACCCACTTCGGG + Intronic
1188272734 X:28160822-28160844 GGCGGTGTGATAAGCATTTGTGG - Intergenic