ID: 1005479324 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 6:26240549-26240571 |
Sequence | GGCGGCGTGAAACGCATTTC GGG |
Strand | + |
Crispr in exon? | Yes |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 29 | |||
Summary | {0: 1, 1: 1, 2: 2, 3: 3, 4: 22} |
Found 4 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1005479319_1005479324 | -4 | Left | 1005479319 | 6:26240530-26240552 | CCGTCGCTTGGCCCGACGCGGCG | 0: 1 1: 0 2: 0 3: 1 4: 41 |
||
Right | 1005479324 | 6:26240549-26240571 | GGCGGCGTGAAACGCATTTCGGG | 0: 1 1: 1 2: 2 3: 3 4: 22 |
||||
1005479315_1005479324 | 4 | Left | 1005479315 | 6:26240522-26240544 | CCCGCCATCCGTCGCTTGGCCCG | 0: 1 1: 0 2: 1 3: 6 4: 53 |
||
Right | 1005479324 | 6:26240549-26240571 | GGCGGCGTGAAACGCATTTCGGG | 0: 1 1: 1 2: 2 3: 3 4: 22 |
||||
1005479317_1005479324 | 0 | Left | 1005479317 | 6:26240526-26240548 | CCATCCGTCGCTTGGCCCGACGC | 0: 1 1: 0 2: 0 3: 1 4: 19 |
||
Right | 1005479324 | 6:26240549-26240571 | GGCGGCGTGAAACGCATTTCGGG | 0: 1 1: 1 2: 2 3: 3 4: 22 |
||||
1005479316_1005479324 | 3 | Left | 1005479316 | 6:26240523-26240545 | CCGCCATCCGTCGCTTGGCCCGA | 0: 1 1: 0 2: 0 3: 2 4: 31 |
||
Right | 1005479324 | 6:26240549-26240571 | GGCGGCGTGAAACGCATTTCGGG | 0: 1 1: 1 2: 2 3: 3 4: 22 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1005479324 | Original CRISPR | GGCGGCGTGAAACGCATTTC GGG | Exonic | ||