ID: 1005479324

View in Genome Browser
Species Human (GRCh38)
Location 6:26240549-26240571
Sequence GGCGGCGTGAAACGCATTTC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 29
Summary {0: 1, 1: 1, 2: 2, 3: 3, 4: 22}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005479319_1005479324 -4 Left 1005479319 6:26240530-26240552 CCGTCGCTTGGCCCGACGCGGCG 0: 1
1: 0
2: 0
3: 1
4: 41
Right 1005479324 6:26240549-26240571 GGCGGCGTGAAACGCATTTCGGG 0: 1
1: 1
2: 2
3: 3
4: 22
1005479315_1005479324 4 Left 1005479315 6:26240522-26240544 CCCGCCATCCGTCGCTTGGCCCG 0: 1
1: 0
2: 1
3: 6
4: 53
Right 1005479324 6:26240549-26240571 GGCGGCGTGAAACGCATTTCGGG 0: 1
1: 1
2: 2
3: 3
4: 22
1005479317_1005479324 0 Left 1005479317 6:26240526-26240548 CCATCCGTCGCTTGGCCCGACGC 0: 1
1: 0
2: 0
3: 1
4: 19
Right 1005479324 6:26240549-26240571 GGCGGCGTGAAACGCATTTCGGG 0: 1
1: 1
2: 2
3: 3
4: 22
1005479316_1005479324 3 Left 1005479316 6:26240523-26240545 CCGCCATCCGTCGCTTGGCCCGA 0: 1
1: 0
2: 0
3: 2
4: 31
Right 1005479324 6:26240549-26240571 GGCGGCGTGAAACGCATTTCGGG 0: 1
1: 1
2: 2
3: 3
4: 22

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005479324 Original CRISPR GGCGGCGTGAAACGCATTTC GGG Exonic