ID: 1005479325

View in Genome Browser
Species Human (GRCh38)
Location 6:26240563-26240585
Sequence CATTTCGGGCCTCATTTATG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 4, 3: 5, 4: 104}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005479316_1005479325 17 Left 1005479316 6:26240523-26240545 CCGCCATCCGTCGCTTGGCCCGA 0: 1
1: 0
2: 0
3: 2
4: 31
Right 1005479325 6:26240563-26240585 CATTTCGGGCCTCATTTATGAGG 0: 1
1: 0
2: 4
3: 5
4: 104
1005479322_1005479325 -2 Left 1005479322 6:26240542-26240564 CCGACGCGGCGGCGTGAAACGCA 0: 1
1: 0
2: 0
3: 0
4: 14
Right 1005479325 6:26240563-26240585 CATTTCGGGCCTCATTTATGAGG 0: 1
1: 0
2: 4
3: 5
4: 104
1005479315_1005479325 18 Left 1005479315 6:26240522-26240544 CCCGCCATCCGTCGCTTGGCCCG 0: 1
1: 0
2: 1
3: 6
4: 53
Right 1005479325 6:26240563-26240585 CATTTCGGGCCTCATTTATGAGG 0: 1
1: 0
2: 4
3: 5
4: 104
1005479319_1005479325 10 Left 1005479319 6:26240530-26240552 CCGTCGCTTGGCCCGACGCGGCG 0: 1
1: 0
2: 0
3: 1
4: 41
Right 1005479325 6:26240563-26240585 CATTTCGGGCCTCATTTATGAGG 0: 1
1: 0
2: 4
3: 5
4: 104
1005479321_1005479325 -1 Left 1005479321 6:26240541-26240563 CCCGACGCGGCGGCGTGAAACGC 0: 1
1: 0
2: 0
3: 2
4: 9
Right 1005479325 6:26240563-26240585 CATTTCGGGCCTCATTTATGAGG 0: 1
1: 0
2: 4
3: 5
4: 104
1005479317_1005479325 14 Left 1005479317 6:26240526-26240548 CCATCCGTCGCTTGGCCCGACGC 0: 1
1: 0
2: 0
3: 1
4: 19
Right 1005479325 6:26240563-26240585 CATTTCGGGCCTCATTTATGAGG 0: 1
1: 0
2: 4
3: 5
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005479325 Original CRISPR CATTTCGGGCCTCATTTATG AGG Exonic